-
No products found
because this supplier's products are not listed.
Samuel W. Kazer, et al.,
bioRxiv - Immunology 2024
Quote:
... Antibodies used: anti-Influenza A virus NS1 (PA5-32243, ThermoFisher), anti-acetyl-α-tubulin (Ly640 ...
-
No products found
because this supplier's products are not listed.
Diego Mourão, et al.,
bioRxiv - Microbiology 2020
Quote:
... and stained with 0.25μg/ml of mouse monoclonal yellow fever antibody (3576) (Santa Cruz, #sc-58083) for 1 hour ...
-
No products found
because this supplier's products are not listed.
James M. Burke, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were incubated with the anti-Influenza A virus NS1 rabbit antibody (GeneTex; GTX125990) at 1:1000 for two hours ...
-
No products found
because this supplier's products are not listed.
Ana C. Alcalá, et al.,
bioRxiv - Microbiology 2019
Quote:
... cells were incubated with mouse anti-NS1 mAb and rabbit anti-SRB1 polyclonal antibody (Abcam, USA) as primary antibodies ...
-
No products found
because this supplier's products are not listed.
Romel Rosales Ramirez, Juan E. Ludert,
bioRxiv - Molecular Biology 2019
Quote:
The NS1 sequence from ZIKV (Mexican isolate, Asiatic linkage) and YFV NS1 (Brazilian yellow fever virus isolate) were synthesized de novo (GenScript, Piscataway, NJ). The synthetic ZIKV NS1 gene (GenBank accession number KY631493.1 ...
-
No products found
because this supplier's products are not listed.
Hongbing Jiang, et al.,
bioRxiv - Microbiology 2019
Quote:
... Anti-influenza A virus NP antibodies (Millipore), Anti-TNK2 (A12 ...
-
No products found
because this supplier's products are not listed.
Tobias Floyd, et al.,
bioRxiv - Microbiology 2021
Quote:
... and anti-canine distemper virus nucleoprotein mouse monoclonal primary antibody (Biorad) in selected fox tissues.
-
No products found
because this supplier's products are not listed.
Chen-xi Zhang, et al.,
bioRxiv - Immunology 2020
Quote:
The serum levels of a total of 12 virus-related cytokines were measured by a bead-based immunoassay panel (Mouse Anti-Virus Panel, Cat No: 740622, Biolegend, USA). The BALF levels of a total of 12 inflammatory cytokines were measured by a bead-based immunoassay panel (Mouse Inflammation Panel ...
-
No products found
because this supplier's products are not listed.
Jinqiang Zhang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... including the primary antibodies (mouse anti-Iba1 antibody, Abcam, 1:400; rabbit anti-iNOS antibody, Abcam, 1:50; mouse anti-GFAP antibody, Cell signaling, 1:400 ...
-
No products found
because this supplier's products are not listed.
Patrick Slaine, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were stained with goat polyclonal antibody to influenza A virus (ab20841, Abcam Inc., Toronto, ON, Canada, mouse-anti G3BP1 (BD Biosciences, 611126), Mouse anti-PABP (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Sundar Ram Sankaranarayanan, et al.,
bioRxiv - Genomics 2019
Quote:
... mouse anti-GFP antibody (Roche) and the HRP conjugated goat anti-mouse secondary antibody (Bangalore Genei) ...
-
No products found
because this supplier's products are not listed.
Justin L. Tosh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... anti-mouse and anti-goat antibodies (Dako) were diluted 1:10,000 in 1% BSA/PBST ...
-
No products found
because this supplier's products are not listed.
Xiufei Chen, et al.,
bioRxiv - Genomics 2024
Quote:
... Mouse anti-NeuN antibody (Merck Millipore ...
-
No products found
because this supplier's products are not listed.
Isha Rana, et al.,
bioRxiv - Pathology 2022
Quote:
... Anti-mouse secondary antibody (Jackson ImmunoResearch) was used to observe nuclear localization
-
No products found
because this supplier's products are not listed.
Yuexia Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-rat and anti-mouse antibodies (GE Healthcare) used at a dilution of 1:5,000 ...
-
No products found
because this supplier's products are not listed.
Bryce K. Allen, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and cluster 2 was pretreated with anti-mouse CD8α antibody (MAb anti-mouse CD8α antibody, CAT BE0061, BioXcell) by intraperitoneal (i.p. ...
-
No products found
because this supplier's products are not listed.
Sarmin Sultana, et al.,
bioRxiv - Genetics 2022
Quote:
... an anti-mouse antibody was used (IRDye 800CW Goat anti-Mouse IgG Secondary Antibody, LI-COR) and imaged by Odyssey (LI-COR Odyssey- 9120).
-
No products found
because this supplier's products are not listed.
Zhu Liu, et al.,
bioRxiv - Biophysics 2019
Quote:
... and mouse anti GAPDH antibody (Proteintech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Laurie-Anne Lamotte, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... together with Anti-Influenza A Non-Structural Protein 1 (NS1) Mouse Monoclonal Antibody (EMB005, Kerafast). Cells were then washed and incubated with a mixture of secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Simon Ng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Lumit anti-mouse antibody-LgBiT (Promega) and Lumit anti-rabbit antibody-SmBiT (Promega) ...
-
No products found
because this supplier's products are not listed.
Edward Armstrong, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Sections from formalin-fixed paraffin-wax embedded tumours were stained with primary rat anti-mouse monoclonal anti-CD8 antibody (eBioscience, 4Sm15as) and goat anti-mouse polyclonal anti-PD-L1 antibody (R&D systems, AF1019). Slides were scanned and imaged using Hamamatsu Nanozoomer (Hamamatsu Photonics).
-
No products found
because this supplier's products are not listed.
Shuwei Xie, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse monoclonal anti-actin antibodies (Novus Biologicals), rabbit polyclonal anti-SNX1 antibodies (Novus Biologicals) ...
-
No products found
because this supplier's products are not listed.
SN Langel, et al.,
bioRxiv - Immunology 2021
Quote:
... goat anti-mouse IgA antibody (Southern Biotech) at a 1:5000 dilution ...
-
No products found
because this supplier's products are not listed.
Justin V. Joseph, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A biotinylated goat-anti-mouse antibody (Vector Laboratories) was used as secondary antibody (dilution 1:200 ...
-
No products found
because this supplier's products are not listed.
Jonas N. Conde, et al.,
bioRxiv - Microbiology 2023
Quote:
... and recLI9-NS1-GFP11 reporter virus was purified using RNeasy kit (Qiagen). cDNA synthesis was performed as above using random hexamer primers (25°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Takuya Hemmi, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-mouse IgG2a antibody (Bethyl Laboratories), or polyclonal anti-mouse IgA antibody (Bethyl Laboratories ...
-
No products found
because this supplier's products are not listed.
Haowei Jiang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... horseradish peroxidase conjugated anti-mouse antibody (Rockland). Bound antibody was detected by chemiluminescence using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Mitchell R. Farrell, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
No products found
because this supplier's products are not listed.
Ismael Fernández-Hernández, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Antibodies used were mouse anti-nc82 (1:10, DSHB) and secondary antibody anti-mouse Cy5 (1:100, Jackson laboratories). No antibodies were used for GFP and RedStinger fluorescent proteins ...
-
No products found
because this supplier's products are not listed.
Yu-Tien Hsiao, Meyer B. Jackson,
bioRxiv - Biophysics 2022
Quote:
... and mouse anti-syb antibody (Synaptic Systems #104211) or mouse anti-RFP antibody (ThermoFisher #MA5-15257 ...
-
No products found
because this supplier's products are not listed.
Hanna Zieger, et al.,
bioRxiv - Neuroscience 2019
Quote:
Secondary antibodies: anti-mouse-HRP (Dianova, 115-035-003), anti-rabbit-HRP (Dianova ...
-
No products found
because this supplier's products are not listed.
Raghu Pandurangi, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-rabbit or anti-mouse peroxidase-conjugated secondary antibody (ABclonal) and diaminobenzidine colorimetric reagent solution purchased from Dako (Carpinteria ...
-
No products found
because this supplier's products are not listed.
Tamás Raskó, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... mouse anti-ZNF24 antibody (1:1000, Abnova, H00007572-M02), Anti-tubulin (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shai Saroussi, et al.,
bioRxiv - Plant Biology 2022
Quote:
... a YSI 5331A electrode (Yellow Springs Instruments, Yellow Springs, OH, USA) polarized at -0.8 V ...
-
No products found
because this supplier's products are not listed.
Lyra O. Randzavola, et al.,
bioRxiv - Immunology 2022
Quote:
... The antibody cocktails included anti-mouse antibodies from Miltenyi Biotec: CD44-FITC (clone IM7.8.1) ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti-S1 antibody (Sino Biological) and rabbit anti-S2 antibody (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Salome Aeschlimann, et al.,
bioRxiv - Cell Biology 2022
Quote:
... monoclonal mouse anti-HA antibody (Enzo Life Sciences AG ...
-
No products found
because this supplier's products are not listed.
Nicolas Altemose, et al.,
bioRxiv - Genomics 2021
Quote:
... mouse anti-H3 antibody (MABI 0301, Active Motif), or rabbit or mouse IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Prasun Chakraborty, Kevin Hiom,
bioRxiv - Cancer Biology 2019
Quote:
... mouse monoclonal anti-BRCA1 antibody (OP92, Ab-1; Calbiochem, for IPs 10μg/ml ...
-
No products found
because this supplier's products are not listed.
Eleni Kafkia, et al.,
bioRxiv - Systems Biology 2020
Quote:
... mouse anti-lamin B1 (1:500, Atlas Antibodies, AMAb91251) and anti-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Mohini Bhupathi, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Typhi (the bacterial pathogen that causes typhoid fever) using 2X Warmstart colorimetric LAMP (M1800, NEB, US). The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe ...
-
No products found
because this supplier's products are not listed.
Sachiko Yamashita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Olivier Dubanet, Michael J. Higley,
bioRxiv - Neuroscience 2023
Quote:
... Primary antibodies: mouse anti-Campari red (1:500 Absolute Antibody) and Guinea-Pig anti Ctip2 (1:500 Synaptic System ...
-
No products found
because this supplier's products are not listed.
Manfei Liang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... eiF4E6(GGGGATCCGCCGAACAAGGG) or Yellow (Addgene #49331) guide sequences were inserted ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2023
Quote:
... tissue sections were incubated with the primary antibody (rabbit polyclonal anti-Influenza A virus NP [ThermoFisher Scientific, PA5-32242] diluted 1:500 in Primary Antibody diluent [Leica Biosystems]) for 30 min at ambient temperature followed by a polymer-labeled goat anti-rabbit IgG coupled with alkaline phosphatase (30 min) ...
-
No products found
because this supplier's products are not listed.
Srikanta Chowdhury, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and CF 488-conjugated anti-mouse antibody (Biotium); all were diluted at 1:1000 in blocking buffer.
-
No products found
because this supplier's products are not listed.
Kate A Lawson, Christina M Ruiz, Stephen V Mahler,
bioRxiv - Neuroscience 2023
Quote:
... and mouse anti-TH antibodies (Immunostar; 1:1000) in PBST-azide with 2% normal donkey serum ...
-
No products found
because this supplier's products are not listed.
Adrien Lesage, et al.,
bioRxiv - Physiology 2023
Quote:
... the anti-FGF13 mouse monoclonal antibody (Antibodies Incorporated, Davis ...
-
No products found
because this supplier's products are not listed.
Daniel Beaudet, et al.,
bioRxiv - Cell Biology 2019
Quote:
... secondary antibodies [anti-rabbit-HRP or anti-mouse-HRP (Cedarlane)] were added as per manufacturer’s instructions in 1× PBS-T for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... labeled using primary antibody (mouse anti-mNEONGreen, 1:1000, ChromoTek) and secondary antibody (goat anti-mouse conjugated with Alexa Fluor 555 ...