-
Nipah Virus Glycoprotein G is a recombinant protein expressed in Mammalian cells.
Cat# abx620134-100UG,
100 µg USD $609.0
Ask
Bálint Kiss, et al.,
bioRxiv - Biophysics 2020
Quote:
... 100 μl of 10 μg/ml SARS-CoV-2 Spike Glycoprotein Antibody (#abx376478, Abbexa Ltd, Cambridge, UK) was then added ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti ZIKV Envelope (#BF-1176-56, BioFront Technologies) and chicken antibody to SENV (#ab33988 ...
-
No products found
because this supplier's products are not listed.
Jieqiong Qu, et al.,
bioRxiv - Microbiology 2023
Quote:
... CHIKV virus stock (5 × 108 TCID50/mL) and full human blood (Sanquin) was 1:2 mixed to make the infectious blood meal with a final virus titer of 1.7× 108 TCID50/ml ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Andre Watson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with pseudotyped lentivirions displaying the SARS-CoV-2 spike glycoprotein (BPS Bioscience). A neutralizing monoclonal IgG antibody against the SARS-CoV-2 spike glycoprotein (CR3022 ...
-
No products found
because this supplier's products are not listed.
Laura Mathä, et al.,
bioRxiv - Immunology 2023
Quote:
... FITC-conjugated anti-mouse anti-mouse T1/ST2 (DJ8) was purchased from MD Biosciences. BV605- conjugated anti-human CD45 (HI30 ...
-
No products found
because this supplier's products are not listed.
Lionel Schiavolin, et al.,
bioRxiv - Microbiology 2024
Quote:
... mouse anti-Albumin (Tebu-bio), rabbit anti-C4BPA (Merck) ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... or vesicular stomatitis virus G (VSV-G, Aldevron), using FuGENE6 (Roche ...
-
No products found
because this supplier's products are not listed.
Ferdinand Roesch, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in RPMI-1640 (Genesee Scientific) media containing 2% FBS and 10 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Pengxiang Chang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in HBS-EP buffer (TEKnova) containing 10 μM oseltamivir carboxylate (Roche ...
-
No products found
because this supplier's products are not listed.
Arianna Consiglio, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and HAM’S F-12 (ECB7502L, Euroclone) 1:1 ...
-
No products found
because this supplier's products are not listed.
Kiyohiko Andoh, Asami Nishimori, Yuichi Matsuura,
bioRxiv - Microbiology 2023
Quote:
... mouse anti-BLV p24 MAb (VMRD: BLV3), mouse anti-His tag MAb (MBL ...
-
No products found
because this supplier's products are not listed.
J. Aaron Crapster, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... anti-ZP3R/mouse sp56 (7C5) (QED Bioscience, 55101, lot 051614-120816, mouse mAb); anti-IZUMO1 (125 ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
Yulia Steblyanko, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-NDC80/HEC1 (1:2000; Nordic Biosite, GTX70268), mouse anti-NuMA (F-11 ...
-
No products found
because this supplier's products are not listed.
Qiang Liu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-SaCas9 (Epigentek, A-9001-100, 1:300), mouse anti-GAD67 (Abcam ...
-
No products found
because this supplier's products are not listed.
Justin J. Botterill, et al.,
bioRxiv - Neuroscience 2021
Quote:
Virus was delivered using a 500nL Neuros Syringe (#65457-02, Hamilton Company) attached to the stereotaxic apparatus with a probe holder (#751873 ...
-
No products found
because this supplier's products are not listed.
Tomas Duminis, et al.,
bioRxiv - Biophysics 2020
Quote:
... and examined using SEM (FEI Inspect F, Oxford Instruments, UK) under a 5KV.
-
No products found
because this supplier's products are not listed.
Hyungsup Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mouse polyclonal anti-ANO9 antibody (1:100, AbFrontier, South Korea), monoclonal anti-c-Fos antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Chongping Li, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and goat anti-mouse IgG secondary antibody (L3032, Signalway Antibody).
-
No products found
Yuanyuan He, et al.,
bioRxiv - Microbiology 2023
Quote:
Imaging plates for virus quantification were prepared by coating coverslip-bottom wells (Cellvis) with 0.18 mg/ml BSA-biotin in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Lorena Cascarano, et al.,
bioRxiv - Physiology 2024
Quote:
... Fat - High-Sucrose (F-HS) diet (Research diets, New Brunswick, USA). The compositions of the diets are detailed in Table 1 ...
-
No products found
because this supplier's products are not listed.
Nia Toshkova, et al.,
bioRxiv - Immunology 2023
Quote:
... measles virus mosaic hemagglutinin (viral proteins were obtained from Immune Technology, New York, NY). Plates were incubated with proteins usually diluted to 5 μg/ml in PBS ...
-
No products found
because this supplier's products are not listed.
Minami Yamada, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... mice were fed a diet containing 0.1% DDC (F-4643; Bio-Serv) for the period indicated.
-
No products found
because this supplier's products are not listed.
Marc Schwab, et al.,
bioRxiv - Neuroscience 2020
Quote:
... As a detection system the Simple Stain MAX PO (MULTI) anti-mouse (Nichirei Biosciences) was used ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
... MSIP 96 well plates were from Millipore (Multiscreen filter plates) and anti-mouse or anti-monkey IFNγ or IL4 capture and detection antibodies were all from U-CyTech. Lymphocytes (from mouse spleens/lungs or macaque PBMC ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... NJ) and were seronegative to IAV antibodies by a commercial ELISA kit (Swine Influenza Virus Ab Test, IDEXX) prior to the start of the study ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... cells were washed and secondary labeling was carried out using a 1:250 dilution of goat-anti-chicken 633 or donkey anti-mouse 633 (Immunoreagents, Raleigh, NC) for 10 minutes on ice ...
-
No products found
because this supplier's products are not listed.
JF Sturgill, et al.,
bioRxiv - Neuroscience 2020
Quote:
... AAV virus (300nL volume) was then pressure injected 100nL/min via a glass pipette pulled (P-97 Sutter Instruments) from borosilicate capillaries (Drummond calibrated 5ul ...
-
No products found
because this supplier's products are not listed.
Manindra Nath Tiwari, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The isolated neurons put in culture in DMEM F-12 (Gemini Bio-Products CAT#: 900-955. Lot# M96R00J) supplemented with Glutamine 2 mM ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... Supernatant was removed and the pellet was re-suspended in CnT-PR-F media (CELLnTECH; Zen-Bio, Research Triangle Park, NC), filtered with 40 µm strainer ...
-
No products found
because this supplier's products are not listed.
Simone Kurz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... mouse brain (Pel-Freez Biologicals), or HEK293 cells (kind gift from Dr ...
-
No products found
because this supplier's products are not listed.
Lay-Sun Ma, et al.,
bioRxiv - Microbiology 2021
Quote:
... The bound proteins were removed by boiling in sample buffer and subjected to immunoblotting analysis using mouse monoclonal anti-6xHis (Yao-Hong Biotech. Inc., TW) and Strep-tagII (IBA Lifesciences, Germany) primary antibodies and the goat anti-mouse IgG-HRP-conjugated secondary antibody (Thermo Scientific ...
-
Cat# HY-P0285-1 mg,
1 mg, USD $180.0
Ask
Wen-Qing Yang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the supernatant was incubated with the anti-HA magnetic beads or anti-Flag magnetic beads (MedChemExpress) with gentle agitation for appropriate time ...
-
No products found
because this supplier's products are not listed.
Hyojung Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 mM EDTA (G-Biosciences, #015E-F), 1X ProteaseArrestTM (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Ceniz Zihni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti–Cdc42-GTP mouse monoclonal (NewEast Biosciences) immunofluorescence 1/50 ...
-
No products found
because this supplier's products are not listed.
Šimon Borna, et al.,
bioRxiv - Immunology 2022
Quote:
... and AAV6 virus (Signagen laboratories, and in house produced (33))-mediated delivery of homologous template containing NGFR reporter gene under control of PGK promoter as described previously (33) ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or bisphenol F (BPF; #A11471, Alfa Aesar, ≥98 %) in 10 mL of corn oil (#405435000 ...
-
No products found
because this supplier's products are not listed.
Araceli Bergadà-Martínez, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-BDNF (mouse, 1:150, 327-100, Icosagen) and anti-actin (mouse ...
-
No products found
because this supplier's products are not listed.
Zhefu Que, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the addition of 100 ng/mL of CD200 (Cluster of Differentiation 200/OX-2 membrane glycoprotein) (ACROBiosystems, Catalog No. 50-101-8369) and 100 ng/mL of CX3CL1 (Fractalkine/ chemokine (C-X3-C motif ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351 was assessed by a surrogate virus neutralization test (cPass Assay, Medac, Wedel, Germany) as described previously (Momsen Reincke et al. ...
-
No products found
because this supplier's products are not listed.
Miho Matsuda, Chih-Wen Chu, Sergei Y. Sokol,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-DYKDDDDK mAb clone 2H8 (Cosmo Bio USA, #KAL- K0602, 1:1000) and mouse anti-GFP mAb clone B2 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
... Supernatant containing released virus was harvested two days post-transfection and filtered through a 0.45 micron filter(GVS) and stored in 0.5ml aliqouts at −80°C ...
-
No products found
because this supplier's products are not listed.
Kevin J. Kramer, et al.,
bioRxiv - Immunology 2021
Quote:
... values at the endpoint (48 h after incubation with the virus) were determined using the RTCA software version 2.1.0 (ACEA Biosciences Inc.). Results are expressed as percent neutralization in a presence of respective antibody relative to control wells with no CPE minus CI values from control wells with maximum CPE ...
-
No products found
because this supplier's products are not listed.
Husam Taher, et al.,
bioRxiv - Microbiology 2020
Quote:
... Detection was performed using an anti-mouse polymer HRP conjugated system (GBI Labs; Cat. No. D12-110), and developed with Alexa-fluor594 conjugated tyramide at a 1:500 dilution for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Marco De Giorgi, et al.,
bioRxiv - Genetics 2023
Quote:
Primary mouse hepatocytes were purchased from BioIVT and cultured in INVITROGRO medium with 10% of fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...