-
No products found
because this supplier's products are not listed.
Zilei Xia, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the SARS-CoV-2 PLpro gene (ORF 1ab 1564−1876) was subcloned from pET28b(+) to pE-SUMO vector according to the manufacturer’s protocol (LifeSensors Inc., Malvern, PA). The forward primer with the Bsa I site is GCGGTCTCAAGGTGAAGTTCGCACCATCAAAGTTTTTACC ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... or vesicular stomatitis virus G (VSV-G, Aldevron), using FuGENE6 (Roche ...
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
... by incubating the yeast with a 1:1000 dilution of Chicken anti C-MYC Epitope Tag Primary Antibody from Exalpha Biologicals Inc ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Fabrizio Clarelli, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and CRP (Mouse α-E. coli CRP, 664304, Nordic Biosite antibodies) were diluted 1:250 ...
-
No products found
Yuanyuan He, et al.,
bioRxiv - Microbiology 2023
Quote:
Imaging plates for virus quantification were prepared by coating coverslip-bottom wells (Cellvis) with 0.18 mg/ml BSA-biotin in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
Naidi Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the body temperature of the mouse was maintained at 37 °C using a homeothermic monitoring system (No. 69020, RWD life science).
-
No products found
because this supplier's products are not listed.
Florian J. Bock, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S63845 (Chemgood, C-1370), Sytox Green (Thermo ...
-
No products found
because this supplier's products are not listed.
Samuel R. Witus, et al.,
bioRxiv - Biochemistry 2023
Quote:
... cells were shifted from 37 °C to 16 °C and supplemented with 1 mM Bpa (dissolved in 1M NaOH; Bachem) and 100 µM ZnCl2 ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Zak Frentz, Jonathan Dworkin,
bioRxiv - Biophysics 2020
Quote:
... through sterile tubing (Cole-Parmer, C-Flex #13, i.d. 0.8 mm), into the perfusion chamber ...
-
No products found
because this supplier's products are not listed.
Iris Bea. L. Ramiro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Consomatin Ro1crystallized after 11 days at 21 °C in SaltRx (Hampton Research), condition D10 (4.0 M Sodium Nitrate ...
-
No products found
because this supplier's products are not listed.
Komal Soni, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... was homogenized at 4°C using 700 µL zirconia beads (BioSpec, 110791) in Precellys 24 homogenizer (Bertin Technologies ...
-
No products found
because this supplier's products are not listed.
M.M. Joglekar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... VCAN (1:200, Mouse Anti-Versican Antibody 2B1, Seikagaku), and ELN (1:400 ...
-
No products found
because this supplier's products are not listed.
Emilie Pondeville, et al.,
bioRxiv - Genetics 2019
Quote:
... Hemocytes were incubated at 4°C overnight with a rat anti-mCD8 antibody (Ancell) diluted 1:100 or a rabbit anti-PPO2 (Fraiture ...
-
Rabbit polyclonal antibody to Hepatitis C Virus
Cat# CPA9927,
200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0
Ask
Yingjuan Liu, et al.,
bioRxiv - Genetics 2020
Quote:
... Secondary antibodies used for IF were goat-anti-mouse H&L FITC (Cohesion Biosciences) or goat-anti-rabbit H&L FITC (Cohesion Biosciences) ...
-
No products found
because this supplier's products are not listed.
Jessica Eira, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Incubation of the secondary antibodies donkey anti mouse Alexa Fluor 568 (1:1000, Alfagene, A10037) and donkey anti rabbit Alexa Fluor 647 (1:500 ...
-
No products found
because this supplier's products are not listed.
Kartikeya Vijayasimha, et al.,
bioRxiv - Immunology 2022
Quote:
... Transfected cells were allowed to recover for two days and were then labelled at 4°C with anti-Thy1.1 antibody (clone HIS51, eBiosciences) for 30 minutes in PBS buffer containing 0.1% BSA (Amresco). Cells were then washed in buffer and incubated with anti-mouse IgG microbeads beads (Miltenyi Biotech ...
-
No products found
because this supplier's products are not listed.
Jinqiang Zhang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... for 24 h and the secondary antibodies (anti-rabbit IgG-conjugated Alexa Fluorochrome or anti-mouse IgG conjugated Alexa Fluorochrome, Invitrogen; 1:500) for 2 h at room temperature.
-
No products found
because this supplier's products are not listed.
Anil Verma, et al.,
bioRxiv - Immunology 2023
Quote:
... were labeled with biotinylated anti-His tag monoclonal antibody (ThermoScientific) and used to capture His-tagged clade C gp120 Du151 protein (Immune Technologies). The gp120-expressing beads were then incubated with triplicate 5-fold dilutions of heat-inactivated serum samples in V-bottom plates for 1h at 37°C ...
-
No products found
because this supplier's products are not listed.
Suranjana Pal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse anti-RFP (1:200; Allele Biotech, catalog #ABP-MAB-RT008 ...
-
No products found
because this supplier's products are not listed.
Sarah Schnabellehner, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-mouse LYVE1 (Reliatech, 103-PA50AG; 1:200), rat anti-mouse EMCN (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Justin J. Botterill, et al.,
bioRxiv - Neuroscience 2021
Quote:
Virus was delivered using a 500nL Neuros Syringe (#65457-02, Hamilton Company) attached to the stereotaxic apparatus with a probe holder (#751873 ...
-
Prostaglandin ( PGE2 ) Multi-Format ELISA / assay Kit
Cat# K051-H5,
1.0 ea, USD $1375.0
Ask
Azure D. Grant, et al.,
bioRxiv - Physiology 2021
Quote:
A commercially available fE2 enzyme-linked immunosorbent assay (ELISA) kit was used to quantify E2 in fecal samples (Arbor Assays, Ann Arbor, MI). These assays have been previously published in species ranging from rats and mice(130–132) ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
Cat# IT-29-250,
250 micrograms,USD $2340.0
Ask
Michelle Dookwah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Anti-p75 antibody (Advanced Targeting Systems, # AB-N07), 1:100 dilution in PBS-T ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2-month-old male or female BALB/C mouse blood preserved with ACD 20% at room temperature was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Frederike Klimm, Thomas Speck, Marc Thielen,
bioRxiv - Plant Biology 2023
Quote:
... by using the primary antibody LM6 ([Anti-1,5-α-L-Arabinan] Antibody, Megazyme Ltd, Bray, Ireland) and a fluorescent marker (Alexa Fluor 568 goat anti-rat IgG (H+L) ...
-
No products found
because this supplier's products are not listed.
Miho Matsuda, Chih-Wen Chu, Sergei Y. Sokol,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-DYKDDDDK mAb clone 2H8 (Cosmo Bio USA, #KAL- K0602, 1:1000) and mouse anti-GFP mAb clone B2 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Wu Liu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2’-C-methyladenosine (2’-C-Me-A) was obtained from Carbosynth Limited (Compton ...
-
No products found
because this supplier's products are not listed.
Yongsung Kim, et al.,
bioRxiv - Genomics 2024
Quote:
42 °C Incubator (Boekel Scientific™ model no ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... and rabbit anti hamster IgA antibody (Brookwood Biomedical, Jemison, AL, dilution: 1:250) were incubated at 4°C overnight followed by washing and incubation with a secondary biotinylated goat anti-mouse IgG antibody (dilution ...
-
Anti-Spike RBD Antibody (RP6-E2) is a monoclonal antibody that is specificly targeting for the...
Cat# A3139, SKU# A3139-1mg,
1mg, $539.00
Ask
Nila Roy Choudhury, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were incubated with virus for 1.5 hours before the addition of virus growth media (DMEM, 0.14% BSA, 1 μg/mL TPCK-treated trypsin) supplemented with 500 μM of Favipiravir (Selleck Chemicals) or DMSO ...
-
No products found
because this supplier's products are not listed.
James Brett Case, et al.,
bioRxiv - Microbiology 2020
Quote:
... Virus was plaque-purified on Vero CCL81 cells in the presence of 25 μg/ml of cytosine arabinoside (TriLink BioTechnologies), and plaques in agarose plugs were amplified on Vero CCL81 cells ...
-
No products found
because this supplier's products are not listed.
Kevin J. Kramer, et al.,
bioRxiv - Immunology 2021
Quote:
... values at the endpoint (48 h after incubation with the virus) were determined using the RTCA software version 2.1.0 (ACEA Biosciences Inc.). Results are expressed as percent neutralization in a presence of respective antibody relative to control wells with no CPE minus CI values from control wells with maximum CPE ...
-
No products found
because this supplier's products are not listed.
Janhavi Prasad Natekar, et al.,
bioRxiv - Microbiology 2022
Quote:
Tissues harvested from virus-inoculated animals were weighed and homogenized in a bullet blender (Next Advance, Averill Park, NY, USA) using stainless steel or zirconium beads ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Arg-C (Biovendor, Cat#RBG40003005), trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Brian C. Russo, et al.,
bioRxiv - Microbiology 2021
Quote:
... The cells were then incubated overnight at 4°C with rabbit anti-Shigella conjugated to FITC (ViroStat, catalog no. 0903). The next day ...
-
No products found
because this supplier's products are not listed.
Claudia C. Carcamo, et al.,
bioRxiv - Biophysics 2022
Quote:
... and a 2.12 µm polystyrene bead coated in anti-digoxigenin antibody (Spherotech cat# DIGP-20-2) was caught in trap 2 which is upstream in the path of buffer flow to trap 1 ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... equipped with a 45 °C diamond knife (Diatome) was used to section the resin embedded samples ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Lisa-Marie Appel, et al.,
bioRxiv - Biochemistry 2022
Quote:
Crystalization was performed at at 22°C or 4°C using a sitting-drop vapour diffusion technique and micro-dispensing liquid handling robot Mosquito (TTP labtech). The best diffracting crystals of SHARP SPOC:1xS5P CTD were grown at 22°C in conditions E9 from ShotGun HT screen (SG1 HT96 Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Lesia Rodriguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Proteins immunoprecipitated with anti-FLAG antibody were separated by SDS-PAGE (4-15% Mini-PROTEAN®TGX™ Precast Protein Gels (Bio-RAD)) ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... by dialysis at 4 °C (1000 g mol-1 MWCO; Spectrum Laboratories), 4 times 6 h ...
-
No products found
because this supplier's products are not listed.
Amanda N. Scholes, Jeffrey A. Lewis,
bioRxiv - Genomics 2019
Quote:
... and then placed in a 65°C preheated Multi-Therm incubated vortexer (Benchmark Scientific) at 1500 rpm for 45 minutes ...
-
No products found
because this supplier's products are not listed.
Domokos I. Lauko, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated overnight at 28°C in Grace’s with 10% FBS (Gemini Bio-Products). Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio ...