-
No products found
because this supplier's products are not listed.
Jean-Philippe Corre, et al.,
bioRxiv - Pathology 2022
Quote:
... platelets using DyLight488-anti-mouse GPIbβ antibody (0.1 μg, #X488, Emfret Analytics) and fibrin deposits using DyLight488-anti-human/mouse fibrin antibody (8 μg ...
-
No products found
Shu Hiragi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-ß-actin mouse monoclonal antibody (Applied Biological Materials, Richmond, BC, Canada; #G043), anti-EEA1 mouse monoclonal antibody (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Tho Huu Nguyen, et al.,
bioRxiv - Genetics 2019
Quote:
... The surface attached cells were fixed in 4% formaldehyde (Polysciences) for 15 min ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Aliquots of incubation medium were collected and insulin secretion was measured with a mouse insulin ELISA kit (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Emma Carley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The surface of 35 mm glass bottomed culture dishes (MatTek corporation) were covered with 200 μl of the mixed gel ...
-
No products found
because this supplier's products are not listed.
Adam D. Wegman, et al.,
bioRxiv - Immunology 2021
Quote:
... and immunostained with flavivirus group-reactive mouse monoclonal antibody 4G2 (Envigo Bioproducts, Inc.), and secondary polyclonal goat anti-mouse IgG PE-conjugated antibody (#550589 ...
-
No products found
because this supplier's products are not listed.
Jinge Gu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Hsp70 (StressMarq Biosciences Inc, SMC-100A/B), mouse anti-GAPDH (Proteintech ...
-
No products found
because this supplier's products are not listed.
M Niklas, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Srinu Tumpara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... allophycocyanin (APC)-conjugated mouse monoclonal anti-CD16 antibody (clone 3G8, Immunotools, Friesoythe, Germany), or BV-480 conjugated anti-CD56 mouse monoclonal antibody (Clone NCAM16.2 ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
Capillaries were identified using rat anti-mouse CD31 antibodies (BMA Biomedicals, Cat#T-2001). Neutrophils were stained with a rat anti-Ly6G (GR1 ...
-
No products found
because this supplier's products are not listed.
Rania Akkawi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by incubation with secondary anti-mouse immunoglobulin antibody for 30 min (Nichirei Biosciences). The reaction was then performed using a DAB peroxidase kit (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... A primary mouse antibody α-C4c (Quidel) was diluted to 1:10,000 followed by a secondary goat α-mouse antibody conjugated to horseradish peroxidase (Thermo Scientific ...
-
WB,IF,IP,IHC,FC,ELISA
Cat# A5712, SKU# A5712-20ul,
20ul, $47.00
Ask
Hongcheng Tang, Jiafeng Zhu, Shuyan Wu, Hua Niu,
bioRxiv - Microbiology 2022
Quote:
... The eluates were further purified with magnetic beads conjugated with mouse anti-FLAG antibody (Bimake, Shanghai, China) (15 μL/dish) ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Adam K. Wade-Vallance, et al.,
bioRxiv - Immunology 2022
Quote:
... Biosearch Technologies]) or control antigen (ovalbumin; OVA [Worthington Biochemicals]) in 20µl PBS by subcutaneous injection ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Frederic Bibollet-Ruche, et al.,
bioRxiv - Immunology 2022
Quote:
... Supernatants were assayed for p27 antigen production by ELISA (Zeptometrix).
-
No products found
because this supplier's products are not listed.
William Bain, et al.,
bioRxiv - Microbiology 2023
Quote:
... goat anti-human anti-C3 antibody (Catalog #A213, Complement Tech) was added at 1:200,000 dilution per manufacturer’s recommendation and incubated at room temperature for 1 hour ...
-
No products found
because this supplier's products are not listed.
Aubin Moutal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or VEGF-B (1nM, Cat#RPU44324, Biomatik) for 30 min before recording ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For binding analysis biotinylated antigen (1 μg/mL) were immobilized on streptavidin (SA) biosensors (Pall) for 300 sec to ensure saturation ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Yunfan Bai, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 μL of IS B (Avanti Polar Lipids Inc.) containing 1.0 nmol monoacylglycerol (MG ...
-
No products found
because this supplier's products are not listed.
Cindy F. Yang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-somatostatin-14 antibody (Peninsula Laboratories, Cat# T-4103.0050, RRID: AB_518614) was raised in rabbit against the first 14 aa of the synthetic peptide SST ...
-
No products found
because this supplier's products are not listed.
Christopher B. Trivedi, et al.,
bioRxiv - Microbiology 2020
Quote:
... and DNA extraction of 2017 surface precipitate samples was extracted using the ZymoBIOMICS™ DNA/RNA Mini Kit (Zymo Research Corp.). All extractions were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
Cat# F107,
USD $169.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Jayne T. Wolfe, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and exposed to a mean fluid SS of 10 dyn/cm2 via warmed PBS perfused by a pulsatile blood pump (#55-1838, Harvard Apparatus, Holliston, MA). The fluid SS value of 10 dyn/cm2 was chosen based on the average SS in the coronary artery ...
-
No products found
because this supplier's products are not listed.
Alyssa N Coyne, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Antigen retrieval was performed using Tissue-Tek antigen retrieval solution (IHC World) for 1 hour in a steamer ...
-
No products found
because this supplier's products are not listed.
Peter Radvak, et al.,
bioRxiv - Immunology 2021
Quote:
... Cutaneous temperature was also measured on mouse tail surface using a rodent infrared thermometer (Braintree Scientific) following infection ...
-
This antibody is a recombinant mouse monoclonal antibody which specifically reacts with...
Cat# MOB-0137MZ,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... The slides were then submerged into Antigen Retrieval Buffer (Antigen Unmasking Solution Citric Acid Based, # H-3300, Vector Biolabs) and the entire unit was placed in a 100°C water bath 15 min ...
-
No products found
because this supplier's products are not listed.
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
... biotinylated recombinant antibodies that were able to bind the antigen were detected with 1/10,000 poly-HRP-conjugated streptavidin (Sanquin) diluted in PTA buffer (100 μL/well ...
-
No products found
because this supplier's products are not listed.
Francisco Javier Villaamil, et al.,
bioRxiv - Epidemiology 2019
Quote:
... antibodies against the p80 antigen were determined using a commercial blocking ELISA(BVD p80 Ab, IDEXX laboratories, the Netherlands), since the antibodies of animals vaccinated with inactivated vaccines react mainly with structural proteins rather than the p125 or p80 antigens (18) ...
-
No products found
because this supplier's products are not listed.
Mariana Galvão Ferrarini, et al.,
bioRxiv - Immunology 2022
Quote:
... and a Coleoptericin B (ColB) primary polyclonal anti-serum (Proteogenix, Schiltigheim-France) at 1:300 dilution in 0.1% BSA were used ...
-
No products found
because this supplier's products are not listed.
Xiaozheng Xu, et al.,
bioRxiv - Cell Biology 2019
Quote:
... SEE (#ET404) super antigen was purchased from Toxin Technology. CD28 monoclonal antibody (#16-0289-85) ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... samples were incubated with primary antibody solutions diluted in blocking buffer including mouse anti-5-mC (1:2000; Epigentek) and rabbit anti-PV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Bettina Zens, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CDMs were scraped off the cell culture dish surface with a cell scraper (Sarstedt, #83.1830) and the matrix was transferred into 1.5 ml centrifugation tubes.
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...