-
No products found
because this supplier's products are not listed.
Caterina Ivaldo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and specific secondary antibodies (anti rabbit/anti mouse IgG-HRP, Euroclone S.p.A, Italy). The blotting membranes were reprobed with loading control antibodies ...
-
No products found
because this supplier's products are not listed.
Cameron Vergato, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-mouse IFNAR-1 antibody or mouse IgG (cat. #MS-GF-ED, Molecular Innovations, Novi, MI) diluted in sterile PBS and injected i.p ...
-
No products found
because this supplier's products are not listed.
Zhenming Jin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Anti-virus Drug Library (Shanghai Institute for Advanced Immunochemical Studies, SIAIS), which includes ∼10,000 compounds ...
-
No products found
because this supplier's products are not listed.
Laura Mathä, et al.,
bioRxiv - Immunology 2023
Quote:
... FITC-conjugated anti-mouse anti-mouse T1/ST2 (DJ8) was purchased from MD Biosciences. BV605- conjugated anti-human CD45 (HI30 ...
-
No products found
because this supplier's products are not listed.
Guillaume Poncelet, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... mouse-anti-mCherry monoclonal (Antibodies.com, A104343) all diluted 1:500 at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Simon N. Chu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3% antibody serum (heat-inactivated; Atlanta Biologicals, Flowery Branch, GA, USA), 2% human plasma (from umbilical cord blood) ...
-
No products found
because this supplier's products are not listed.
Joanna J. Moss, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and anti-mouse (G32-62G, 1:10,000, SignalChem) horseradish peroxidase-conjugated antibodies at room temperature for 1 hr before exposure on photographic film (28906844 ...
-
No products found
because this supplier's products are not listed.
Joep Joosten, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... mouse-anti-Lamin A (Nordic-MUbio, cat# 1101P), rabbit-anti-Lamin B1 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Tomasz M. Grzywa, et al.,
bioRxiv - Immunology 2021
Quote:
... Anti-DNP antibodies (Life Diagnostics, Inc) at concentration 1 U/ml were used for overnight incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Subeena Sood, et al.,
bioRxiv - Immunology 2023
Quote:
... A fixed concentration of SARS-CoV-2 GFP pseudotyped virus (BPS Biosciences) was added and the plate incubated for 60 minutes at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Priya Katyal, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Anti-Atsttrin antibody was supplied by Lampire Biological Laboratories (Pipersville ...
-
No products found
because this supplier's products are not listed.
Nia Toshkova, et al.,
bioRxiv - Immunology 2023
Quote:
... measles virus mosaic hemagglutinin (viral proteins were obtained from Immune Technology, New York, NY). Plates were incubated with proteins usually diluted to 5 μg/ml in PBS ...
-
No products found
because this supplier's products are not listed.
Han-Wei Shih, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Alexa 647-conjugated anti-CWP1 antibody (Waterborne, New Orleans, LA) was used at 1:2,000 ...
-
No products found
because this supplier's products are not listed.
Nicolas Millet, et al.,
bioRxiv - Immunology 2021
Quote:
... Neutrophils were incubated in duplicate wells of flat bottom 96-well plates containing hyphae that had been grown for 3 hours with or without serum opsonization (2% heat-inactivated mouse serum; Gemini Bio-Products), at a neutrophil to C ...
-
No products found
because this supplier's products are not listed.
Adriana Tomic, et al.,
bioRxiv - Systems Biology 2019
Quote:
CMV and Epstein-Barr virus (EBV) analysis was performed using CMV IgG ELISA (Calbiotech, Cat No CM027G) and EBV-VCA IgG ELISA (Calbiotech ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Primary antibodies: rabbit anti-NeuN (1:500, Biosensis, R-3770–100). Sections were then incubated in species-appropriate fluorescent secondary antibodies with minimal cross-reactivity for 2 hours in PBS-Tx with 2% NDS at room temperature ...
-
No products found
because this supplier's products are not listed.
Takanori Eguchi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
The antibodies used were anti-MZF1 (C10502, Assay Biotechnology, 1:500), anti-CDC37 (D11A3 ...
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
... Supernatant containing released virus was harvested two days post-transfection and filtered through a 0.45 micron filter(GVS) and stored in 0.5ml aliqouts at −80°C ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Christopher M. Jernigan, et al.,
bioRxiv - Neuroscience 2019
Quote:
Affinity-purified goat polyclonal anti-AmOA1 antibodies (21st Century Biochemicals, Inc. Marlborough, MA) were raised against a synthetic peptide acetyl-AMRNDRSPSYSMQVPQQGC-amide ...
-
No products found
because this supplier's products are not listed.
Karin Wuertz-Kozak, et al.,
bioRxiv - Physiology 2020
Quote:
... Primary antibodies used in this study were: anti-PGP 9.5 (Biotrend, Cologne, Germany), anti-GAP 43 (Millipore ...
-
No products found
because this supplier's products are not listed.
Ludmila Recoules, et al.,
bioRxiv - Genomics 2021
Quote:
... Rabbit anti- mH2A1.1 antibody was generated according to immunization protocol from Agro-Bio - La fierté Saint-Aubin – France ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... and rabbit anti hamster IgA antibody (Brookwood Biomedical, Jemison, AL, dilution: 1:250) were incubated at 4°C overnight followed by washing and incubation with a secondary biotinylated goat anti-mouse IgG antibody (dilution ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Kevin J. Kramer, et al.,
bioRxiv - Immunology 2021
Quote:
... values at the endpoint (48 h after incubation with the virus) were determined using the RTCA software version 2.1.0 (ACEA Biosciences Inc.). Results are expressed as percent neutralization in a presence of respective antibody relative to control wells with no CPE minus CI values from control wells with maximum CPE ...
-
No products found
because this supplier's products are not listed.
Janhavi Prasad Natekar, et al.,
bioRxiv - Microbiology 2022
Quote:
Tissues harvested from virus-inoculated animals were weighed and homogenized in a bullet blender (Next Advance, Averill Park, NY, USA) using stainless steel or zirconium beads ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marcus Buggert, et al.,
bioRxiv - Immunology 2020
Quote:
... bulk memory or virus-specific CD8+ T cells were sorted into cold fetal bovine serum and frozen in RNAzol (Molecular Research Center). TCRβ transcripts were amplified using a template-switch anchored RT-PCR ...
-
No products found
because this supplier's products are not listed.
Valentina Rossio, et al.,
bioRxiv - Biochemistry 2020
Quote:
Commercial antibodies used for Western blotting analysis were as follow: anti-Ube2C (A-650, Boston Biochem), anti-ubiquitin (P4D1 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jason Small, Alison Weiss,
bioRxiv - Microbiology 2021
Quote:
... Cells were washed with PBST and placed in primary antibody (Rabbit Anti-E. coli, cat. 1001, ViroStat, Rabbit Anti-Intimin ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Shuvasree SenGupta, et al.,
bioRxiv - Immunology 2021
Quote:
... and Purecol® (3 mg/mL, 5005, Advanced Biomatrix) in a 1:2:15 ratio ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...