-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Aminata P. Coulibaly, et al.,
bioRxiv - Neuroscience 2019
Quote:
The arterial tree of each mouse was labeled using the vascular dye Microfil (Flow Tech, Carver, MA), and the cross-sectional MCA diameter was measured ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Hanako Ono, et al.,
bioRxiv - Genomics 2019
Quote:
Cultured mouse organoids derived from a single cell were harvested and treated with Accumax (Innovative Cell Technologies, AM105) to generate a single-cell suspension ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
LC Laboratories' Product Number C-6000 - Cyclosporin A (Cyclosporine, Ciclosporin A, Ramhyphin...
Cat# C-6000, SKU# C-6000_100g,
100 g, $996.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Szi Kay Leung, et al.,
bioRxiv - Neuroscience 2023
Quote:
Raw reads were processed and de-multiplexed with Iso-Seq (v3), aligned to the mouse reference genome (mm10, GENCODE) using pbmm246 (v1.10.0, a Minimap2 wrapper adapted for PacBio data ...
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Mengjie Li, et al.,
bioRxiv - Microbiology 2024
Quote:
Total RNA was extracted from mouse lung tissue using an RNA extraction kit according to the manufacturer’s instructions (BioMiGA, China). All materials required for the experiment were treated with DPEC water to remove RNA enzyme (BioMiGA ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Malene E Lindholm, et al.,
bioRxiv - Genetics 2020
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from newly born rats using the neonatal rat/mouse cardiomyocyte isolation protocol from Cellutron (nc-6031) according to the specifications from the manufacturer ...
-
UNC119–cargo interaction inhibitor
Sold for research purposes only.
Cat# 2778.0, SKU# 2778-10 mg,
10mg, US $137.50 / EA, EURO, €125 / EA
Ask
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
Cat# SA12000,
Coupling buffer+ Washing buffer + EDC, USD $76.00/KIT
Ask
Sahil Shah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Then the promoter activities were tested in C20 human microglia and SIM-A9 mouse microglia cell lines using Glial-Mag kit (OZ Bioscience, Cat # GL002500). The cells were cultured under standard conditions and seeded into 96-well plates at a density of 3.0×104/100 μl ...
-
No products found
because this supplier's products are not listed.
Kryslaine L. Radomski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Twenty-to-fifteen representative images from each mouse were collected at 5,000x magnification using a JEOL JEM-1011 TEM (JEOL USA Inc., Peabody, MA) and an AMT XR50S-A digital camera (Advanced Microscopy Techniques ...
-
No products found
because this supplier's products are not listed.
B. van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... was used for MDA-MB-436 and mouse targeting shEXO1 (see Table 1 for sequence, cloned in pRSITEP-U6Tet-sh-EF1-TetRep-2A-Puro from Cellecta Catalog #: SVSHU6T16-L) was used for MEFs.
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
No products found
because this supplier's products are not listed.
Anna Tasegian, et al.,
bioRxiv - Physiology 2024
Quote:
... a 50% conditioned media (1:1 dilution in advanced D-MEM/F12 base media) was generated from genetically modified L-WRN mouse fibroblast cell line (ATCC, #CLR-3276™, ATCC, LGC Standards, Middlesex, UK) cultured in advanced D-MEM/F12 (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Laura-Marie A. Zimmermann, et al.,
bioRxiv - Biochemistry 2022
Quote:
... anti-tropoelastin (#PR385, Elastin Products Company, Owensville, MO, USA; IF:1:200), anti-MMP-13 (#ab39012 ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Chenxi Li, et al.,
bioRxiv - Immunology 2024
Quote:
... Emissions from QDs and antibodies were separated by a beam splitter (T 580 lpxxr, Chroma Technology Corp, Bellows Falls, USA), then captured by two Rolera EM2 cameras and processed using VisiView software (Visitron Systems GmbH ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Beatriz A. Osuna, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 110 ng of anti-CRISPR expression plasmids with 1.25 µl of TransIT-X2 (Mirus Bio) in 20 µl Opti-MEM ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Raphael Trenker, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Ligand-coated anti-Flag beads were serially 3x washed with Buffer A containing 0.5 mM DDM (Anatrace) and eluted with Buffer A containing 0.5 mM DDM and 250 µg/ml of Flag peptide (SinoBiological) ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).
-
No products found
because this supplier's products are not listed.
Abdoulie O. Touray, et al.,
bioRxiv - Microbiology 2023
Quote:
... ChIP was performed with a total of 15 µg of sonicated chromatin and 10 µg of Mab anti-V5 (BioShop Canada Inc.). The antibodies were cross-linked to Protein G Mag Sepharose Xtra (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Beatriz A. Osuna, et al.,
bioRxiv - Microbiology 2019
Quote:
The binding affinities of anti-CRISPR proteins to SpyCas9 were calculated using microscale thermophoresis (MST) on the Monolith NT.115 instrument (NanoTemper Technologies GmbH, Munich, Germany). For AcrIIA1/AcrIIA2b.3 with WT or mutant Cas9-gRNA complexes ...