-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Carlo Dal Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-alpha-tubulin (α-tubulin) (EXBIO Praha, Czech Republic) diluted 1:500 ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
George D. Moschonas, et al.,
bioRxiv - Microbiology 2023
Quote:
... culture medium was supplemented with recombinant human interferon-alpha 2 alpha (rhIFN-a2a) (#11343504, ImmunoTools), doxycycline (#D9891 ...
-
No products found
because this supplier's products are not listed.
Jordan Demone, et al.,
bioRxiv - Bioengineering 2021
Quote:
... titration curves of conformation-dependent monoclonal IgM (Absolute Antibody, Ab01680-15.0), IgA (Absolute Antibody ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... L-alpha-phosphatidylserine (Avanti polar lipids 840032C), and L-alpha-phosphatidylethanolamine (Avanti polar lipids 840026C ...
-
No products found
because this supplier's products are not listed.
Veronica Gonzalez, et al.,
bioRxiv - Genomics 2021
Quote:
... that contained alpha-thio-ddNTPs (Trilink Bio Technologies) at equal ratios at a concentration of 1200 μM in the final amplification reaction ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Jeong Yeon Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Asserchrome D-dimer ELISA (#100947) from Stago (Asnières sur Seine, France) and Mouse total fibrinogen (#IMSFFBGKTT) from Innovative Research (Novi, MI) was used to analyse the samples in duplicates.
-
No products found
because this supplier's products are not listed.
Eline Lemerle, et al.,
bioRxiv - Cell Biology 2022
Quote:
... myotubes were grown on alpha-numerically gridded bottom dishes (Ibidi, France). Adherent plasma membranes were obtained by sonication and were immediately immersed in 4% paraformaldehyde and the proteins of interest were then labeled by immunofluorescence in saturation buffer (1% BSA in KHMgE buffer) ...
-
No products found
because this supplier's products are not listed.
Yitong Ma, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The growth media consisted of Alpha MEM Earle’s Salts (Irvine Scientific) with 10% Tet Approved FBS (Clontech Laboratories or Avantor ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Mayis Kaba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Alpha Fluor 488 amine (20 μg/mL, AAT Bioquest/Cat No. 1705) was added at room temperature for 30 min with agitation before overnight incubation with hIgG ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Li-Feng-Rong Qi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The amount of alpha-synuclein in cells was imaged by fluorescence microscopy (Nikon Ts2R).
-
No products found
because this supplier's products are not listed.
Nathan Hodson, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and visualized using a Fluorochem E Imaging system (Protein Simple; Alpha Innotech, Santa Clara, CA). Bands were quantified using Protein Simple AlphaView SA software and normalized to Ponceau S and a gel control (identical generic sample run on every gel).
-
No products found
because this supplier's products are not listed.
I.R. Akberdin, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Another target of calmodulin is Ca2+/calmodulin-dependent protein kinase kinase 2 (CAMKK2) that phosphorylates AMPK Thr172 thereby activating the kinase (Abbott et al., 2009). In turn ...
-
No products found
because this supplier's products are not listed.
Anissa A. Widjaja, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the telomere length and mitochondrial copy number for mouse tissues were evaluated by RT-qPCR with the Relative Mouse Telomere Length Quantification qPCR Assay Kit (M8908, ScienCell) and Relative Human Mitochondrial DNA copy number Length Quantification qPCR Assay Kit (M8938 ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Maria Manali, et al.,
bioRxiv - Microbiology 2022
Quote:
... HEK293T cells were transfected with the appropriate SARS-CoV-2 Spike gene expression vector (Wuhan, Alpha, Delta, or Omicron) together with p8.9171 and pCSFLW72 using polyethylenimine (PEI, Polysciences, Warrington, USA). HIV (SARS-CoV-2 ...
-
No products found
because this supplier's products are not listed.
Maximilian W. G. Schneider, et al.,
bioRxiv - Cell Biology 2021
Quote:
... To 22.5 μl of the resulting supernatant, 2.5 μl 10 mM guanylyl-(alpha, beta)-methylene-diphosphonate (GMPCPP) (Jena Biosciences, NU-405) were added to a final concentration of 1 mM and the resulting solution incubated at 37°C in a water bath in the dark for 30 min ...
-
No products found
because this supplier's products are not listed.
Maria Jose Lista, et al.,
bioRxiv - Microbiology 2021
Quote:
... a set of overlapping cDNA fragments representing the entire genomes of SARS-CoV-2 Wuhan isolate (GenBank: MN908947.3) and the B.1.1.7 alpha variant were chemically synthesized and cloned into pUC57-Kan (Bio Basic Canada Inc and Genewiz, respectively). The cDNA fragment representing the 5’ terminus of the viral genome contained the bacteriophage T7 RNA polymerase promoter preceded by a short sequence stretch homologous to the XhoI-cut end of the TAR in yeast vector pEB2(Gaida et al. ...
-
No products found
because this supplier's products are not listed.
Aurelie de Rus Jacquet, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The number of CD63+ EVs collected in the EV-enriched fractions were estimated by ELISA (System Biosciences). The ELISA standards provided in the kit are calibrated by NTA to measure the number of exosomes and establish a standard curve based on exosome abundance ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Cristiana Bersaglieri, et al.,
bioRxiv - Genomics 2020
Quote:
... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
No products found
because this supplier's products are not listed.
Ramhari Kumbhar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-PAR (4335-MC-100; Trevigen), rabbit anti-pan PAR (MABE1016 ...
-
No products found
because this supplier's products are not listed.
Jeffrey L Hansen, Barak A Cohen,
bioRxiv - Genomics 2021
Quote:
... or goat anti-mouse (Epicypher #13-0048) polyclonal secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...