-
No products found
because this supplier's products are not listed.
Dmitry Shvarev, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-(cytidine diphosphate) (DAG) were purchased from Avanti Polar Lipids (Alabama, USA). Phosphatidylinositol 3-phosphate (PI3P ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Robin Mesnage, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Potential metabolic activation was included in the ToxTracker assay by addition of S9 liver extract from aroclor1254-induced rats (Moltox). Cells were exposed to five concentrations of the test samples in the absence and presence of 0.25% S9 extract and required co-factors (RegenSysA+B ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Mike T. Veling, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 1.25 μM of the DEVD peptide for detecting caspase activation (Sartorius 4440). The plates were sealed with sterile Breathe-Easy film (USA scientific 9123-6100 ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and another on rifampicin-induced PHHs (BioIVT, lot BGW). Cells were thawed and 18,000 live cells/well were seeded into collagen-coated 384-well plates as described above ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Fran van Heusden, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Activation of excitatory cortical afferents was performed via a bipolar stimulating electrode (FHC Inc., USA) placed in the external capsule ...
-
No products found
because this supplier's products are not listed.
Alison D. Parisian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human induced pluripotent stem cell (iPSC) line iPS12 was purchased from Cell Applications. This cell line is integration-free and was validated for pluripotency ...
-
No products found
because this supplier's products are not listed.
Seung-Yon Lee, et al.,
bioRxiv - Physiology 2024
Quote:
... was induced to differentiate using AdipoLife DfKt-2 Adipogenesis media (LifeLine Cell Technology), with medium changed every two days ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Megan Davis-Fields, et al.,
bioRxiv - Biophysics 2019
Quote:
... for immune activation and a 1:100 dilution of fluorescent beads (0.955μm polystyrene Dragon Green beads, purchased from Bangs Laboratories) for microscopic visualization ...
-
No products found
because this supplier's products are not listed.
Yasmin Bay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... agonist-induced increases in fluorescence intensity from an intracellular Ca2+-sensitive dye (Fluo8, AAT Bioquest) were measured in GluK1 and GluK2 expressing cells cultured in 96-well plates using a FlexStation I plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Alessandra Mozzi, et al.,
bioRxiv - Microbiology 2022
Quote:
Autophagy was induced by amino acid and serum starvation in Earle’s Balanced Salt Solution (EBSS, ECB4055L, Euroclone) for the indicated times.
-
No products found
because this supplier's products are not listed.
Shun Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
AAV9 mediating the expression of Pharmacologically Selective Activation Module (PSAM) (Magnus et al., 2011; Saxena et al., 2013) were obtained from Vector Biolabs (Malvern-PA, US), at the titers of 6 × 1012 viral genomes/ml ...
-
No products found
because this supplier's products are not listed.
Annika Ullrich, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and the plasmids for G protein activation (the ratio of receptor/Gα/Gβ/Gγ was 4/1/2/8) using linear polyethyleneimine (PEI, Polysciences, 3:1 PEI:DNA ratio) (65 ...
-
No products found
because this supplier's products are not listed.
Ryan Borem, et al.,
bioRxiv - Bioengineering 2020
Quote:
... IVDD was induced via percutaneous intradiscal injection (29-gauge needle) of 1U of C-ABC (Amsbio, Cambridge, MA) in 200 µL of vehicle (sterile 0.1% bovine serum albumin in 1x PBS - Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Georg Hafner, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Anesthesia was induced with 3% isoflurane (vol/vol) and maintained between 0.5 and 1% throughout the entire surgical procedure (Harvard Apparatus, USA). Mice were mounted on a custom-built frame with rigid earbars ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Lola Holcomb, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse serum samples were diluted 10-fold using the kit-specific reagent (SPCKA-MP-007374, Protein Simple, Bio-Techne), and the concentrations were measured following the manufacturer’s instructions on the Ella system ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ramhari Kumbhar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-PAR (4335-MC-100; Trevigen), rabbit anti-pan PAR (MABE1016 ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Sirisha Thippabhotla, Cuncong Zhong, Mei He,
bioRxiv - Bioengineering 2019
Quote:
The RNA library was prepared by using the commercial library preparation kit NEXTflex small RNA sequencing kit (Bioo Scientific, NOVA-5132-05) following the recommended protocol by the manufactures ...
-
No products found
because this supplier's products are not listed.
Yurika Ito, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Single iPS cells carrying an inducible MYOD1 activation system were expanded in Primate ES cell medium (Reprocell) without bFGF and with 10µM of Y-27632 (Nacalai tesque ...
-
No products found
because this supplier's products are not listed.
Seungju Cho, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Muscle atrophy was induced by immobilization of the hindlimb of normal mice using non-elastic bandage tape (MultiporeTM Sports White Athletic Tape, 3M Japan, Japan) and hook-and-loop fastener (Velcro® tape ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...