-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
Recombinant AAV-2 VP1 Protein was expressed in E. coli.
Cat# VP1-1787A,
10ug , USD $298
Ask
Sunil Yeruva, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were coated with 2 µg ml-1 recombinant human DSG2 (Creative Biomart; #DSG2-1601H) in 100 mM bicarbonate/carbonate coating buffer (3.03 g Na2CO3 ...
-
No products found
because this supplier's products are not listed.
Julio C.Y. Liu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... ML-792 (SUMOi; 2 μM, MedKoo Biosciences), MLN-7243 (Ub-E1i ...
-
No products found
because this supplier's products are not listed.
Rajashree A. Deshpande, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
D. Hoving, et al.,
bioRxiv - Immunology 2023
Quote:
... serum from a donor 3 weeks post-PCV13 vaccination was diluted 1:100 in 0.5% BSA in PBS with 10µg/mL cell wall PS multi (CWPS-multi; SSI Diagnostica; 68866 ...
-
No products found
because this supplier's products are not listed.
Juan A Perez-Bermejo, et al.,
bioRxiv - Genetics 2021
Quote:
... High purity iPS-CM cultures (iCell Cardiomyocytes2, Lot#CMC331743, >99% cTnT+) were obtained from Cellular Dynamics International (Madison ...
-
No products found
because this supplier's products are not listed.
Jakob Trendel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... cycloheximide 100 µg/ml) on a BIOCOMP153 gradient station (BioComp Instruments). Supernatants were transferred onto the sucrose gradients and subjected to 3.5 hours of ultracentrifugation with 35000 rpm in a Sorvall WX90 ultracentrifuge (Beckman ...
-
No products found
because this supplier's products are not listed.
Mohammed Samer Shaban, et al.,
bioRxiv - Immunology 2020
Quote:
... and Dylight488-conjugated (ImmunoReagents #DkxMu-003D488NHSX, 1:100) secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Jasvinder S. Ahuja, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were pelleted and resuspended in 4 mL YPD broth containing 100 µg/mL nourseothricin sulfate (Neta Scientific) and aerated at 30°C for 12 h ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech), Nε-Boc-L-lysine (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Marc Ramos-Llorens, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All FA substrates (>98–99% pure) used for the functional characterisation assays were obtained from Nu-Chek Prep, Inc ...
-
No products found
because this supplier's products are not listed.
Danielle G. May, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... chicken anti-BioID2 (1:5000; BID2-CP-100; BioFront Technologies) or mouse anti-hemagglutinin primary antibody was used (HA ...
-
No products found
because this supplier's products are not listed.
Lucile Fievet, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and incubated in 1.5 mL of collagenase (NB5, 1 U/mL, Nordmark Biochemicals) for 60 min at 37°C ...
-
No products found
because this supplier's products are not listed.
JH Larsen, et al.,
bioRxiv - Pathology 2023
Quote:
... using primary antibodies BS66 (BSH-7459-100, Nordic Biosite, 1:1000), SMMS-1 (M3558 ...
-
No products found
because this supplier's products are not listed.
Xuan He, et al.,
bioRxiv - Immunology 2021
Quote:
... The plates were washed with coulter buffer and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 μg/mL). The plates are washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase antibody from Southern Biotechnology (1 μg/mL) ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Keith D Runnalls, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Self-adhesive Ag-AgCl electrodes (Blue Sensor N; Ambu, Denmark) were placed approximately 2 cm apart in a bipolar montage over the belly of each muscle ...
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2 ml of concentrated extracellular medium were applied on top of a qEV column (Izon Science) and 6 ml fractions were collected ...
-
No products found
because this supplier's products are not listed.
Natalie J. Norman, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 999 ± 2 µg/ml in 0.2% (v/v) HNO3(CGC1) inorganic carbon standard (Inorganic Ventures, USA). All other chemicals and salts were trace metal grade (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Coral K. Wille, et al.,
bioRxiv - Genetics 2023
Quote:
... 1x PBS) and probed for 1 hour in blocking buffer containing α-NANOG (1:100; Cosmo Bio USA, REC-RCAB001P or 1:1000 ...
-
No products found
because this supplier's products are not listed.
Nannan Guo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... NICD (rabbit anti-cleaved Notch1, Assay Biotech Cat# L0119 RRID:AB_10687460 at 1:100) immunostaining was performed as described (66).
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... the arrays were probed at 1/100 dilution in protein array blocking buffer (GVS) supplemented with E ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Joseph W. Fowler, et al.,
bioRxiv - Cell Biology 2022
Quote:
Cells were washed in PBS and treated for 1hr with plain EBM-2 containing 2.5μg/mL DiI-LDL (Kalen Biomedical). Cells were washed for 5min with acid wash (25mM Glycine ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Yuanchen Yu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The channel array was maintained at 37 °C with a TC-1-100s temperature controller (Bioscience Tools). For all direct comparisons ...
-
No products found
because this supplier's products are not listed.
Timothy Q. Vu, Lucas E. Sant’Anna, Neha P. Kamat,
bioRxiv - Bioengineering 2022
Quote:
... Triton-X-100 (LabChem) was purchased from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Alexander Popov, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The sections were incubated for 48 hours in monoclonal (clone 3C12) mouse anti-Ezrin antibodies (1:100, Diagnostic BioSystems, Pleasanton ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lewis, et al.,
bioRxiv - Biophysics 2022
Quote:
... pZ(PConst-TetX-GFP)-containing cells were diluted 1:100 in PBS and analyzed using a Novocyte Flow Cytometer (ACEA Biosciences).
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Cody A. Cushing, et al.,
bioRxiv - Neuroscience 2023
Quote:
... measured by the Behavioral Activation Scale (BAS) and Eysenck Personality Questionnaire-Neuroticism (EPQ-R-N) (Carver & White, 1994; Eysenck & Eysenck, 1993). Participants were ineligible if meeting any of the following criteria ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Priscille Riondel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using the vertical PC-100 puller (Narishige International Ltd) and filled with an internal solution supplemented with 10 μM of the fluorescent dye AlexaFluor 594 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Victor Chaumeau, et al.,
bioRxiv - Microbiology 2024
Quote:
... dirus mosquitos with a Hemotek membrane feeding system (Blackburn, United Kingdom) using 1-mL reservoirs covered with stretched Parafilm (Bemis, USA). The assay was carried out with 5-7 day-old nulliparous female imagoes starved by removing the wet towel covering the cage and the sugar source for 4 to 6 hrs before the feed ...
-
No products found
because this supplier's products are not listed.
Ayodeji B. Oyenihi, et al.,
bioRxiv - Microbiology 2024
Quote:
... Historical vaginal specimens (n = 946) marked for disposal were received in OneSwab® (Copan Diagnostics, CA, USA) or ThinPrep® (Hologic, MA, USA) transport media in a Clinical Laboratory Improvement Amendments (CLIA)-certified infectious disease laboratory facility between January and June 2023 and stored at −80 °C were selected randomly for this study ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Akash D. Chakraborty, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2 (1:5000, Badrilla), CSQ2 (1:3000 ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
Maximiliano José Nigro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit IgG anti-SST (1:1000, BMA Biomedicals), Rabbit IgG anti-VIP (1:1000 ...