-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL kinase reaction was performed with 2 ug/mL recombinant human ULK1 protein (1-649, SignalChem #U01-11G) and 80 ug/mL myelin basic protein (MBP ...
-
No products found
because this supplier's products are not listed.
Wenfei Sun, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 10 ug of targeting vector was co transfected with 40 ug pDP8 and 200 ul PEI (1 mg/ml) in a P15 of 293AAV cells (AAV-100, Cell biolabs), at 40% confluence ...
-
No products found
because this supplier's products are not listed.
Jacob J. Kennedy, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 μm and a trap (IntegraFrit™ Capillary, 100 μm ID × 2 cm, New Objective) packed with Magic C18 AQ ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Aereas Aung, et al.,
bioRxiv - Immunology 2021
Quote:
... Fresh 1 mg/mL stock solutions of Sulfo-Cyanine 3 (21320, Lumiprobe) and -Cyanine 5 (23320 ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Marcelo Febo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ‘Leakproof’ bottles (100 ml, graduated by 1 ml) with stoppers and sipper tubes were purchased (Braintree Scientific Inc ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Guodong Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 ug RNA per sample were used to reverse transcript the cDNA by QuantScript RT Kit (TIANGEN Biotech, KR103). 2 x iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Luis F. Schachner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and mono- and di-methylated at K36 (EpiCypher #16-0322 and #16-0319) were desalted 10 times into 150 mM ammonium acetate using 30 kDa MWCO spin filters prior to MS analysis.
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... To fabricate the silver ring electrodes a silver wire (ø: 635 μm; A-M Systems, WA., USA) was cut into pieces of 1 cm length and one end was curved and welded to form a close loop ...
-
No products found
because this supplier's products are not listed.
Czarina Ramos, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and with primary antibody against GluK2/3 (1 µg/ml) overnight and then with secondary antibodies linked to 1.4-nm gold particles (1:100; Nanogold; Nanoprobes) for 4 h ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 h incubation at RT) and 1-2 μg/mL of HRP-conjugated secondary antibody (ABIN1981272, antibodies-online) in 50 μL/well supplemented with PBS/1% casein or PBS/5 % NCS for 45 min incubation at RT.
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Jun Feng, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... We used the following antibiotics when required including 100 µg mL-1 carbenicillin (Carb, IBI Scientific), 25 µg mL-1 erythromycin (Em ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Matthew D. Slein, et al.,
bioRxiv - Immunology 2023
Quote:
... The cells were then washed with PBS + 1% BSA prior to staining with 100 µL of 1 µg/mL biotinylated goat anti-guinea pig C3 antibody (ICL labs) at room temperature for 1 hour ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Mariya A. Prokhorenko, Jeremy T. Smyth,
bioRxiv - Neuroscience 2023
Quote:
... were conducted by placing a group of 10-12 flies in a round chamber 3 mm high with a 35 mm diameter (Vellum translucent paper glued to a 3D printed ring) on a heat block (Benchmark Scientific) set to 38° ...
-
No products found
because this supplier's products are not listed.
Francesco Petrelli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit-OCT3 (Alpha Diagnostics, 1:100) (63) ...
-
No products found
because this supplier's products are not listed.
Nina Braun, et al.,
bioRxiv - Biophysics 2021
Quote:
... cell pellets were resuspended in 1 mL PBS pH 7.4 containing 100 nM biotinyl-PcTx1 (Phoenix Pharmaceuticals, CA, USA) and transferred into 12 well plates (Orange Scientific) ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Julie Jézéquel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-tagRFP (1:100, Evrogen AB233), goat anti-chicken biotin (1:200 ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μl Detection Buffer 1 (CisBio) was immediately added to the reaction mixture ...
-
No products found
because this supplier's products are not listed.
Ana Cristina Colabardini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... RNA extraction was processed through six cycles of beating in 1 ml ice-cold TRIzol with ∼100 μl volume of silica beads using Bullet Blender (Next Advance). RNA was extracted as previously described (Rio ...
-
No products found
because this supplier's products are not listed.
Jiyeon Leem, Jae-Sung Kim, Jeong Su Oh,
bioRxiv - Cell Biology 2022
Quote:
... anti-centromere (1:100, 15-234, Antibodies Incorporated), anti-CIP2A (1:500 ...
-
No products found
because this supplier's products are not listed.
Fan Bu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ly6C (1:100; E-AB-70362, Elabscience, China), P65 (1:100 ...
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... and IPTG (99%) from Omega Scientific (Tarzana, CA).
-
No products found
because this supplier's products are not listed.
Stanislav Jabinski, et al.,
bioRxiv - Microbiology 2023
Quote:
Medium water samples (2 mL) or CO2 headspace (2 mL) gas were injected into a helium-flushed 12 mL exetainer vials (Exetainer, Labco Limited, UK). Water samples were acidified with 0.1 mL 85% H3PO4 and left to equilibrate for at least 24 hours before measurement ...
-
No products found
because this supplier's products are not listed.
Nai-Wen Chi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and GCK (rabbit polyclonal, Aviva Inc. Cat. OAAF05763, 3 μg/ml). Similar staining patterns were observed (not shown ...
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 0.3% glucose) supplemented with 2 μg/ml doxycycline (BioGems) and dual SMAD inhibitors 0.1 μM LDN-193189 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hiroe Suda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... TSK gel ODS-100V (2 mm ID x 150 mm, 3 µm, Tosoh, Tokyo, Japan). The column was eluted with a linear gradient from 30 to 90% mobile phase B (0.1% formic acid in acetonitrile ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...