-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... instrument calibration was performed by imaging 100-nm biotinylated Gold nanoparticles (Cytodiagnostics) with 532 nm excitation and 100 ms time-resolution over 10 s ...
-
No products found
because this supplier's products are not listed.
Lucia Zubizarreta, et al.,
bioRxiv - Neuroscience 2023
Quote:
Calibration curves were made from certified reference standards (Cerilliant Co., Round Rock, TX) prepared in 50% HPLC-grade methanol ...
-
No products found
because this supplier's products are not listed.
Valerie L. Hedges, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The slides and a C14 standard calibration strip (American Radiolabeled Chemicals, St. Louis, MO, USA) were loaded into autoradiography cassettes and exposed to film (Kodak ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Rosalba Perrone, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Slides were then subjected to a hematoxylin counterstain by incubating slides in the following solutions for described times: 2 minutes in Modified Mayer’s Hematoxylin (StatLab, McKinney, TX, HXMMHGAL), 2 washes with dH20 ...
-
No products found
because this supplier's products are not listed.
MA Laine, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... total N = 99) Sprague-Dawley rats were purchased from a commercial breeder (Charles River, MA), and acclimated to the vivarium for 7 days before the start of handling ...
-
No products found
because this supplier's products are not listed.
Jacqueline A. Burke, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the solution from b) and c) were collected and measured using an insulin ELISA kit (Thermo Fisher for mouse islets, and Mercodia for human islets). The stimulation index was defined as the ratio of stimulated (high glucose ...
-
No products found
because this supplier's products are not listed.
Xiao Du, et al.,
bioRxiv - Genomics 2020
Quote:
... (b) All SVs detected by PacBio CCS Reads and supported by either PacBio CLR or ONT were retained ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... B.1.351 (Beta; Cube Biotech # 28721), P.1 (Gamma ...
-
No products found
because this supplier's products are not listed.
Andreia R. Fernandes, et al.,
bioRxiv - Cell Biology 2021
Quote:
actin depolymerizer Latrunculin B (Focus Biomolecules) and actin stabilizer Jasplakinolide (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... supplemented with hygromycin B (PhytoTechnology Laboratories) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Stefanie K. Menzies, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... typus venom (Product code L1403, origin South Africa, purity >99%) was sourced from Latoxan (Portes les Valence, France) and stored at 4 °C to ensure long-term stability ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2 µg/mL Latrunculin B (Cambridge Bioscience), 0.1 mM DTT (Promega ...
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Marvin Reich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Activity assays for cathepsin B (Abnova, KA0766), cathepsin D (Abnova ...
-
No products found
because this supplier's products are not listed.
Yasmin Fareed, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
Pooled biofluid samples for matrix-matched calibration were obtained as follows: lithium-heparin plasma was purchased from Innovative Research (Novi, Michigan). Pooled urine was provided by an Austrian female volunteer who avoided the consumption of food and use of cosmetics stored in plastic containers ...
-
No products found
because this supplier's products are not listed.
Charlotte Decourt, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Using modified fine forceps (Fine Science Tools; Dumont #5SF Forceps ...
-
No products found
because this supplier's products are not listed.
Kailash Ramlaul, et al.,
bioRxiv - Biophysics 2023
Quote:
... using modified sections of PVC tubing (Gilson) connected at either end to a short length of 1/16” PEEK tubing ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Quantifoil R 0.6/1 Cu300 grid and incubated for 15-30 sec at 99% humidity in a Cryoplunge 3 (Gatan). The grid was blotted from both sides for 2.5-3 sec with Whatman grade 3 paper and plunged into liquid ethane at −175°C.
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Paola Handal-Marquez, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the ML (Modified Lowry) Protein Assay (G-Biosciences) was used following the Microtube ML-Protein Assay Protocol (1.5-2.0ml Assay Tubes).
-
No products found
because this supplier's products are not listed.
Shana M. Owens, et al.,
bioRxiv - Microbiology 2020
Quote:
... live B cells were isolated with Lympholyte-M (Cedarlane) according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Youssef El Mouali, et al.,
bioRxiv - Microbiology 2024
Quote:
... Solutions of arabinan (Megazyme), arabinoxylan (Megazyme) ...
-
No products found
because this supplier's products are not listed.
Fabio Palmieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... in BronchiaLife™ B/T complete medium (Lifeline Cell Technology, USA) supplemented with 0.5% Phenol Red solution (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Sample was combined with Biomix B and BirA (as per Avidity protocol) and incubated at 4°C for 14 hours ...
-
No products found
because this supplier's products are not listed.
Yijia Liow, et al.,
bioRxiv - Microbiology 2023
Quote:
... and (b) control diet (D21052808, Research Diets, Inc., New Brunswick, NJ, USA), as shown in Fig 1 ...
-
No products found
because this supplier's products are not listed.
Molly Brady, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a NIRF filter set (Semrock ICG-B, IDEX Health & Science LLC Rochester NY) and camera (Prosilica GT1380 ...
-
No products found
because this supplier's products are not listed.
Sharon Tran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RapiClear® 1.49 solution (SunJin Lab, RC149001) was used instead in accordance with the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Kwasi Adu-Berchie, et al.,
bioRxiv - Immunology 2022
Quote:
... The tetrazine modified alginate was subsequently purified first by tangential flow filtration (KrosFlow KR2i; Spectrum Labs) against a 150mM to 0mM decreasing NaCl gradient with a 1kDa MWCO membrane ...
-
No products found
because this supplier's products are not listed.
Alex Matsuda, et al.,
bioRxiv - Microbiology 2022
Quote:
... 4 µl of 16× SAH-d2 conjugate solution (Cisbio) was added ...
-
No products found
because this supplier's products are not listed.
Thibault Bourdin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... A solution of 0.5x Band Sharpener (Bio Basic Inc., Markham, Canada) was included for the gabR mixture only ...
-
No products found
because this supplier's products are not listed.
Krishnendu Chakraborty, et al.,
bioRxiv - Immunology 2021
Quote:
... genomic DNA was extracted using the DirectPCR Lysis solution (Viagen Biotech) containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega) ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... D-Luciferin Potassium Salt (>99%) was purchased from Syd Labs. LY294002 ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Celia Segui-Perez, et al.,
bioRxiv - Cell Biology 2022
Quote:
... b-actin (Bioss, bs-0061R), MUC13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Juan A Perez-Bermejo, et al.,
bioRxiv - Genetics 2021
Quote:
... High purity iPS-CM cultures (iCell Cardiomyocytes2, Lot#CMC331743, >99% cTnT+) were obtained from Cellular Dynamics International (Madison ...
-
No products found
because this supplier's products are not listed.
Maria Sendino, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The CRM1 inhibitor Leptomycin B (Apollo Scientific) was used at a final concentration of 30 ng/ml for 3 h.
-
No products found
because this supplier's products are not listed.
Iria Folgueira, et al.,
bioRxiv - Microbiology 2019
Quote:
... Molecular weights were estimated using a calibration curve (Log10 MW vs Rf) constructed with a prestained protein standard (NZY Colour Protein Marker II, Nzytech, Portugal).
-
No products found
because this supplier's products are not listed.
Xiaojuan Fan, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The modified VDR sequences were synthesized (GENEWIZ) and cloned into BsmBI digested vector.
-
No products found
because this supplier's products are not listed.
Joshua A. Broussard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse U100 anti-desmocollin 1a/b (Progen, 65192); mouse anti-vinculin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
B-LCLs were expanded in CELLine bioreactor flasks (Wheaton) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Jamie L. Marshall, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5′-CE (b-cyanoethyl) phosphoramidites were purchased from Glen Research and were dissolved in anhydrous acetonitrile to obtain a concentration of 0.1M ...
-
No products found
because this supplier's products are not listed.
Marlies E. Oomen, et al.,
bioRxiv - Genomics 2023
Quote:
... Centromeres were labeled with the pan-centromeric probe CENP-B-Cy5 (PNA Bio, F3005). After DNA FISH and CENP-B probe labeling ...
-
No products found
because this supplier's products are not listed.
Salome Funes, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1uL of saline solution (Bioworld, 40120975-2) was injected contralaterally (2 mm in front of bregma ...
-
No products found
because this supplier's products are not listed.
Sarah R. McLarnon, et al.,
bioRxiv - Physiology 2022
Quote:
... Slides were then placed in antigen retrieval solution (IHC-Tek Epitope retrieval solution (IHC world cat#IW-1100-1L)) for 40 minutes in a steamer ...
-
No products found
because this supplier's products are not listed.
Frances Xia, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Probes were cleaned using Tergazyme solution (1%, Alconox) overnight and rinsed using deionized water before reusing or storage.
-
No products found
Bryan D. Ryder, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1% GlutaMax in Dulbecco’s modified Eagle’s medium) in a 96-well glass bottom plate (Cellvis, P96-1.5-N). 75ng DNAJB8-mRuby3 plasmids were separately co-transfected into the cells using lipofectamine 2000 (Invitrogen) ...