-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
No products found
because this supplier's products are not listed.
Alexandre Prola, et al.,
bioRxiv - Physiology 2024
Quote:
... anterior hindlimb compartments of 2/3-months-old C57BL6/J mice were injected with adeno-associated virus serotype 9 (AAV9 – Vector Biolabs) carrying either transgenes for STIM1 (AAV9-CMV-mStim1-2A-eGFP ...
-
No products found
because this supplier's products are not listed.
Maaike Allers, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Purified protein was shipped for antibody production (custom polyclonal antibodies, Eurogentec). Rabbit polyclonal anti-Shp1 was purified in house by affinity purification ...
-
No products found
because this supplier's products are not listed.
Ashok Pabbathi, et al.,
bioRxiv - Biophysics 2021
Quote:
... We diluted the microtubules in BRB80T (BRB80 with 20 μM Taxol (paclitaxel, J62734, Alfa Aesar, Tewksbury, MA)) and pelleted them in an air-driven centrifuge at 30 psi (Airfuge ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2020
Quote:
Antibody heavy and light chain variable regions were synthesized as FragmentGENES (GENEWIZ®, South Plainfield, NJ) and subsequently cloned into corresponding Igγ1 ...
-
No products found
because this supplier's products are not listed.
Wei-Hua Chiu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and adeno-associated virus (AAV) particles were injected with a Nanoject 3 (Drummond scientific) at a speed of 1 nl/sec for 30 secs injection with 30 secs pause for a total 33 cycles (i.e. ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Kang Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Gamma RBD (ACROBiosystems, Cat No. SPD-C52Hr), Delta RBD (ACROBiosystems ...
-
No products found
because this supplier's products are not listed.
Prabhu S. Arunachalam, et al.,
bioRxiv - Immunology 2021
Quote:
... or IgA (α-chain specific, Alpha Diagnostics, 1:4’000 dilution) in PBS-T containing 1% non-fat milk was added and incubated for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Bengt Svensson, et al.,
bioRxiv - Biophysics 2023
Quote:
... Residual native CaM was stripped from SR by incubation with 300 nM of the M13 skeletal muscle myosin light-chain kinase CaM-binding peptide (Anaspec, Fremont, CA, USA), as described previously [35] ...
-
No products found
because this supplier's products are not listed.
I. Pediaditakis, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Glial fibrillary acidic protein (GFAP) and Gluceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody provided by RayBiotech was used as the loading control.
-
Cat# HY-P0181-1 mg,
1 mg, USD $132.0
Ask
Jessica Ciesla, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Interferon gamma (IFNγ, Medchemexpress #HY-P70610-50UG) were solubilized to 100 μg/mL concentration in sterile H2O and stored as 12 μL aliquots at -80C ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Xu Dong, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibody information is as follows: Actived-Caspase-3 p17 polyclonal antibody (BS7004; Bioworld, USA; 1: 500) Cleaved Caspase-8 (Asp391 ...
-
No products found
because this supplier's products are not listed.
Sophie J. Hesketh, et al.,
bioRxiv - Cell Biology 2022
Quote:
For stable expression of mScarlet (mSc) tagged IFT-A proteins (IFT144, IFT140, IFT122, IFT121, and IFT139) and associated mutants using the Super PiggyBac system (System Biosciences), the relevant open reading frames were inserted into the PB-EF1α-MCS-IRES-Neo vector with C-terminal TEV ...
-
No products found
because this supplier's products are not listed.
Arnav Gupta, et al.,
bioRxiv - Genomics 2022
Quote:
... and IL-8 levels were quantified from streptavidin-Horseradish peroxidase associated with the detection antibody using absorbance read by an Infinite M1000 plate reader (Tecan).
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Heidi Peussa, et al.,
bioRxiv - Bioengineering 2022
Quote:
... transmitted light (T-PMT) was used to focus the stimulation laser to the DR1-glass layer and defined regions of interest (3 x 5 rectangles á 7×400 pixels ...
-
No products found
because this supplier's products are not listed.
Ceciel Jegers, et al.,
bioRxiv - Biochemistry 2022
Quote:
NanoDSF and light scattering of purified proteins were measured with a Prometheus NT.48 (Nanotemper, Munich, Germany), equipped with back-reflection optics or with a Prometheus Panta (Nanotemper ...
-
No products found
because this supplier's products are not listed.
Marina P Volegova, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-cleaved caspase 3 antibody (Biocare CP229A) at 1:250 dilution ...
-
No products found
because this supplier's products are not listed.
Mathieu Ferrari, et al.,
bioRxiv - Immunology 2021
Quote:
Physical particles were determined by measuring p24 levels using the QuickTitre™ Lentivirus Titre which quantifies lentivirus-associated HIV rather than free p24 proteins (Cell Biolabs – VPK-107-T). Manufacturer’s protocol was followed ...
-
No products found
because this supplier's products are not listed.
Gang Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACE2 protein primary antibody (BOSTER, Lot#BST19874624) and β-actin protein primary antibody (ABclonal ...
-
No products found
because this supplier's products are not listed.
Jürgen Graf, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Emission light was separated from excitation light using a 670-nm dichroic mirror (670 DCXXR, Chroma Technology), short-pass filtered at 680 nm and detected by a photomultiplier tube (12 bit ...
-
No products found
because this supplier's products are not listed.
Laura O’Regan, et al.,
bioRxiv - Cancer Biology 2019
Quote:
For live cell microtubule stability assays cells were grown in µ-well 8 well chamber slides (ibidi). Cells were incubated with 25 nM SiR-Tubulin (Cytoskeleton Inc. ...
-
No products found
because this supplier's products are not listed.
Fatema Akter, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 181.2 mg/ml light or 13C615N2 lysine (Cambridge Isotope Laboratories, Inc., CNLM-291-H-1), and 87.8 mg/ml light or 13C615N4 arginine (Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Jin Nakashima, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The resin was then polymerized at 4°C under UV light for 3 days using a PELCO UVC3 Cryo Chamber (Ted Pella, Redding, CA, USA). Serial semi-thin sections (0.25 μm thick ...
-
No products found
because this supplier's products are not listed.
Owen Leddy, Forest M. White, Bryan D. Bryson,
bioRxiv - Immunology 2022
Quote:
MHC-I-associated peptides were purified using 10 kDa molecular weight cutoff filters (Pall NanoSep) as previously described,15 snap-frozen in liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Biyong Liu, et al.,
bioRxiv - Cell Biology 2024
Quote:
The BC0510 Mitochondrial Respiratory Chain Complex I Activity Assay Kit produced by Solarbio was used to detect the activity of respiratory chain complex I ...
-
No products found
because this supplier's products are not listed.
Jonas Dittrich, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Plasmid extraction and polymerase chain reaction (PCR) purification kits were ordered from Macherey-Nagel GmbH & Co ...
-
No products found
because this supplier's products are not listed.
Zongyue Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with fiber optic cold light sources (V-Lux 1000, Harvard Apparatus). To reduce the movement of brain tissue during imaging ...
-
No products found
because this supplier's products are not listed.
Xiaochuan Zhao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Dynamic light scattering measurements were performed in 96-well plates (Greiner) using a DynaPro plate reader-II (Wyatt Technologies) ...
-
No products found
Iga Kucharska, et al.,
bioRxiv - Microbiology 2020
Quote:
The mAb 3D11-expressing hybridoma cell line variable heavy and light chain antibody genes were sequenced (Applied Biological Materials Inc). mAb 3D11 VK and VH regions were cloned individually into custom pcDNA3.4 expression vectors immediately upstream of human Igκ and Igγ1-CH1 domains ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
SMN upregulator
Sold for research purposes only.
Cat# 2438.0, SKU# 2438-50 mg,
50mg, US $401.50 / EA, EURO, €365 / EA
Ask
Jonathan Bayerl, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Gamma Secretase / NOTCH pathway inhibitor (DBZ 0.35µM – Axon Medchem 1488), BRAFi (SB590885 ...
-
No products found
because this supplier's products are not listed.
Moritz Gerster, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and segmented “1–3–3–1” electrode DBS-LFP (Abbott St ...
-
No products found
because this supplier's products are not listed.
Ebrahim Elsangeedy, et al.,
bioRxiv - Physiology 2024
Quote:
... rabbit anti-peroxisome proliferator-activated receptor gamma (PPARγ; 1:1200 dilution; Biorbyt, LLC, Durham, NC, USA; Cat#: orb11291), rabbit anti-GPER (1:200 dilution ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Joao Pedro Werneck-de-Castro, et al.,
bioRxiv - Physiology 2020
Quote:
... and Branched-chain amino acid enriched diet (BCAA; cat no D07010503; 67 % of carbohydrate, 23 % protein and 10% fat Research Diets). The BCAA has 150% more leucine ...
-
No products found
because this supplier's products are not listed.
Madhu Tiwari, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The VirE2 protein was detected by the anti-VirE2 polyclonal antibody (G-Biosciences, 1:10000) and anti-rabbit secondary antibody (Sigma ...
-
No products found
because this supplier's products are not listed.
Meryem T. Ok, et al.,
bioRxiv - Cell Biology 2022
Quote:
... FITC-associated fluorescence was measured by CLARIOstar Plus Microplate Reader (BMG Labtech, Ortenberg, Germany) after excitation at 483 nm and detection at 530 nm ...
-
No products found
because this supplier's products are not listed.
Elsa Obergfell, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The elution fractions containing the trxA-14-3-3 or trxA-BIN2 fusion proteins were loaded onto a 5 ml Strep-Tactin Superflow High Capacity column (IBA Lifesciences), washed with buffer A and eluted in buffer A supplemented with 2.5 mM desthiobiotin ...
-
No products found
because this supplier's products are not listed.
Vytautas Navikas, et al.,
bioRxiv - Biophysics 2020
Quote:
... the light is focused on an sCMOS camera (Photometrics, Prime 95B ...
-
No products found
because this supplier's products are not listed.
Tegan A. Otto, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Spheroplasts were collected by centrifugation (20rcf, 10min, RT) and plated on 50mm Glass Bottom dishes (No. 1.5 uncoated, gamma irradiated, MatTek Corporation) coated with 0.1mg/mL ConcanavalinA for 10 min ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Anne Trinh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Amino acids concentration assay (μmol/l) was performed by high-performance liquid chromatography (Shimadzu C18 column, Kyoto, Japan) associated with tandem mass spectrometry (Sciex 3200 Qtrap, Framingham, MA) using the aTRAQ kit for amino acid analysis of physio-logical fluids (Sciex) ...
-
No products found
because this supplier's products are not listed.
Therese de Neergaard, et al.,
bioRxiv - Immunology 2022
Quote:
Human monocytic cell line Tamm–Horsfall protein 1 (THP-1) (TIB-202, male; American Type Culture Collection) was cultured in RPMI 1640 medium (Sigma-Aldrich ...