-
No products found
because this supplier's products are not listed.
Kuan-Ying A. Huang, et al.,
bioRxiv - Microbiology 2020
Quote:
... or Middle East Respiratory Syndrome coronavirus (MERS) antigen (spike glycoprotein extracellular domain: Sino Biological, China) or human coronavirus OC43 antigen (spike glycoprotein extracellular domain ...
-
No products found
because this supplier's products are not listed.
Eva Fisher, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant human coronavirus SARS-CoV-2 spike glycoprotein S1 (Fc Chimera) (ab272105, Abcam) was used as positive control (loaded 2.4 ug/lane) ...
-
No products found
because this supplier's products are not listed.
M. A. Rossotti, et al.,
bioRxiv - Bioengineering 2021
Quote:
Recombinant coronavirus spike glycoproteins S (Table S1) were coated overnight onto NUNC® Immulon 4 HBX microtiter plates (Thermo Fisher) at 50 ng/well in 100 µL of PBS ...
-
No products found
because this supplier's products are not listed.
Martin P. Steinbuck, et al.,
bioRxiv - Immunology 2020
Quote:
... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
No products found
because this supplier's products are not listed.
Adam R. Barno, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... K-mer filtering (which removes reads with a 31-mer match to an Illumina spike-in), and Entropy filtering (>0.90 ...
-
No products found
because this supplier's products are not listed.
Taehun Lim, et al.,
bioRxiv - Microbiology 2023
Quote:
... SARS-CoV-2 spike protein (S1) (#E5S3V) and GAPDH (G9545, Sigma-Aldrich) were incubated overnight at 4 °C in TBS-T ...
-
No products found
because this supplier's products are not listed.
Naoki Iwanaga, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 2 μg/mL recombinant spike glycoprotein receptor binding domain (RBD) from SARS-CoV-2 (BEI RESOURCES) or recombinant S1 subunit (RayBiotech) overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... and 1μg truncated coronavirus spike expressing plasmids (SARS: Addgene #170447 ...
-
No products found
because this supplier's products are not listed.
Elena Kudryashova, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant SARS-CoV-2 Spike glycoprotein was purchased from R&D Systems (Minneapolis, MN). Bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Hangu Nam, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Fc Tag (ACROBiosystems). To obtain comparable live cell counts between conditions ...
-
No products found
because this supplier's products are not listed.
Andre Watson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with pseudotyped lentivirions displaying the SARS-CoV-2 spike glycoprotein (BPS Bioscience). A neutralizing monoclonal IgG antibody against the SARS-CoV-2 spike glycoprotein (CR3022 ...
-
No products found
because this supplier's products are not listed.
Laura Pellegrini, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SARS-CoV-2 spike glycoprotein (1:200, GeneTex, GTX632604), rabbit anti-SARS-CoV-2 spike glycoprotein C-terminal (1:200 ...
-
No products found
because this supplier's products are not listed.
Setsuko Mise-Omata, et al.,
bioRxiv - Immunology 2022
Quote:
... Recombinant human SARS-CoV-2 spike S1 IgG lyophilized antibody (Clone AM009105, BioLegend) was used as a standard.
-
No products found
because this supplier's products are not listed.
Andreas Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
No products found
because this supplier's products are not listed.
Oluwadamilola D Ogunjinmi, et al.,
bioRxiv - Microbiology 2023
Quote:
The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
Recombinant Antigen
Cat# REC31847-100,
100µg USD $525.0
Ask
Fred D. Mast, et al.,
bioRxiv - Biochemistry 2021
Quote:
Recombinant Fc-tagged SARS-CoV-2 Spike S1 and S2 proteins purified from HEK293 cells were used for llama immunization (The Native Antigen Company REC31806 and REC31807). For affinity isolation ...
-
No products found
because this supplier's products are not listed.
Andrea R. Shiakolas, et al.,
bioRxiv - Immunology 2020
Quote:
... MERS-CoV S1 was purified over a Superdex200 Increase column (GE Life Sciences). SARS-CoV-2 S-2P ...
-
No products found
because this supplier's products are not listed.
Julio Aguado, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
No products found
because this supplier's products are not listed.
Sherif Salah, et al.,
bioRxiv - Immunology 2022
Quote:
Different SARS-CoV-2 coronavirus antigen concentrations (5, 10, 20, 40, and 80 μg/ml) of spike protein (S1) (by ProSci Inc.), nucleocapsid protein ...
-
No products found
because this supplier's products are not listed.
Kentaro Uemura, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-coronavirus antibody (MAB9013, Merck Millipore), SARS-CoV-2 nucleocapsid antibody (HL344 ...
-
No products found
because this supplier's products are not listed.
Michael Korenkov, et al.,
bioRxiv - Immunology 2023
Quote:
... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jenifer Vallejo, et al.,
bioRxiv - Immunology 2021
Quote:
... Cells were aliquoted to a count of 1 million cells each and incubated on ice with Fc Block (BD, Table S1) at a 1:20 dilution ...
-
No products found
because this supplier's products are not listed.
Ik-Jung Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1:2,000 dilution) (rabbit anti-anti-Spike S2, Cell Signaling, Cat #: 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep ...
-
No products found
because this supplier's products are not listed.
Andrew C. Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sections were incubated for 45 minutes at room temperature with the anti-SARS spike glycoprotein antibody 3A2 (rabbit, Abcam ab272420 1:100 diluted in Dako REAL antibody diluent #S2022), which has been validated in previous publications20,41 ...
-
No products found
because this supplier's products are not listed.
Bin Zhou, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV-2 S1-614D and S1-614G tagged with human IgG Fc fragment were constructed by insertion of the S1 region (residues 1-681) to pFUSE-hIgG1-Fc1 vector (InvivoGen, USA) and expressed using the Expi293 Expression system (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Benjamin J. Meckiff, et al.,
bioRxiv - Immunology 2020
Quote:
Pools of lyophilized peptides covering the immunodominant sequence of the spike glycoprotein and the complete sequence of the membrane glycoprotein of SARS-CoV-2 (15-mer sequences with 11 amino acids overlap) were obtained from Miltenyi Biotec (Thieme et al., 2020) resuspended and stored according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Asheley P. Chapman, et al.,
bioRxiv - Immunology 2020
Quote:
... His-S1 or ecto-spike proteins were plated on half-area high-binding 96-well polystyrene plates (Corning) at 1 μg/mL or 0.5 μg/mL ...
-
No products found
because this supplier's products are not listed.
Marc Labadie, et al.,
bioRxiv - Genetics 2020
Quote:
A custom-made oligonucleotide-based (60-mer length) platform designed (Roche NimbleGen) from non-redundant Fragaria vesca strawberry sequences (Fv_v1.0 Shulaev et al ...
-
No products found
because this supplier's products are not listed.
Brett Stern, Peter Monteleone, Janet Zoldan,
bioRxiv - Bioengineering 2022
Quote:
Viral spike protein (either SARS-CoV-2 Spike Protein, S1 Subunit, RayBiotech, or MERS-CoV-1 Spike Protein, S1 Subunit, BioVision) was added to endothelial culture media of CD34+ iPSC-EP-laden hydrogels at a concentration of 10 μg/mL either one or five days after cell encapsulation ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by Western blot as previously described.21 Densitometry was performed to quantify the cleavage efficiency of full-length spike to S1/S2 subunits using ImageLab 6.0.1 (Bio-Rad #12012931). The average results of two experiments were presented.
-
No products found
because this supplier's products are not listed.
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... with biotinylated 21-mer H3K4me2 peptide (Active Motif, 81041) at 0.5µg/ml of 2h ...
-
No products found
because this supplier's products are not listed.
A. Green, et al.,
bioRxiv - Microbiology 2020
Quote:
... Human Coronavirus Strain HCoV-229E (#VR-740) was sourced from ATCC (American Type Culture Collection) and high titer viral stocks were propagated and maintained by BioScience Laboratories Inc (Bozeman ...
-
No products found
because this supplier's products are not listed.
Sylwia D. Tyrkalska, et al.,
bioRxiv - Immunology 2021
Quote:
... wild type Spike S1 (cat. #RP01262), Spike S1+S2 (cat. #RP01283LQ) and Envelope protein (E, cat. #RP01263) (from ABclonal), flagellin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Ling Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... These sample series were transferred to a plate pre-coated with the spike glycoprotein S1-RBD from SARS-CoV-2 (Elabscience, China, E-EL-E605). After 2 h of incubation ...
-
No products found
because this supplier's products are not listed.
Tarlan Mamedov, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or anti-SARS-COV2 COVID 19 Spike Protein Coronavirus Monoclonal Antibody (MyBioSource, cat. no. MBS2563837). The image was taken using highlysensitive GeneGnome XRQ Chemiluminescence imaging system (Syngene ...
-
No products found
because this supplier's products are not listed.
M. A. Rossotti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Then plates were washed 10 times with PBST and binding of VHHs to S1-Fc was detected with rabbit anti-6xHis Tag antibody HRP Conjugate (Bethyl Laboratories, Cat#A190-114P), diluted at 10 ng/mL in PBST and added at 100 µL/well ...
-
No products found
because this supplier's products are not listed.
Camilla Tiezzi, et al.,
bioRxiv - Immunology 2022
Quote:
... p8.74 packaging vector, pseudotyping vector coding for Spike glycoproteins (Wuhan-Hu-1; B.1 Lineage, China) and pREV with PEI (Polysciences, Inc., Warrington, PA, USA) (1 mg/mL in PBS ...
-
No products found
because this supplier's products are not listed.
Laura Alonso-Herranz, et al.,
bioRxiv - Immunology 2020
Quote:
HEK293 cells (Lonza) were cultured in DMEM (Lonza ...
-
No products found
because this supplier's products are not listed.
Xiao Ma, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
No products found
because this supplier's products are not listed.
Erdem D. Tabdanov, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The resultant molding nanosurface is then cut in 1×1 cm squares by diamond pencil scribbling (on the reverse side of nano-surface) and precoated with biotinylated and fluorescent tag-labeled anti-Fc Fab antibody fragment (Jackson Immunoresearch; 0.1 mg/mL PBS solution ...
-
No products found
because this supplier's products are not listed.
Colten Lankford, Jon Houtman, Sheila Baker,
bioRxiv - Biochemistry 2021
Quote:
... Lysates were quantified by BCA assay and equal total protein concentrations were analyzed by western blotting against the SNAP-tag with membranes imaged for SNAP-HCN1 conjugated SNAP-Cell TMR-star (600 nm channel on LI-COR Odyssey FC) prior to blocking.
-
No products found
because this supplier's products are not listed.
Berislav Bošnjak, et al.,
bioRxiv - Immunology 2022
Quote:
... FCS files were analyzed using FCS Express V7 (De Novo Software) or FlowJo V10 (BD).
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-SARS-CoV-2 Virus Spike 1 [S1] IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S1 subunit spike protein ...
-
No products found
because this supplier's products are not listed.
Muthukumar Ramanathan, et al.,
bioRxiv - Pathology 2021
Quote:
Spike RBD proteins were labeled using Monolith His-Tag Labeling Kit RED-tris-NTA (NanoTemper Technologies) following manufacturer protocol at 2:1 protein to dye ratio ...
-
No products found
because this supplier's products are not listed.
Erica Bello, et al.,
bioRxiv - Neuroscience 2023
Quote:
... coli Spike-in DNA (EpiCypher) was added to each sample to normalise reads to control for experimental variability and sequencing depth ...
-
No products found
because this supplier's products are not listed.
Daniyal J Jafree, et al.,
bioRxiv - Pathology 2024
Quote:
... rabbit polyclonal anti-glycoprotein M6A (GPM6A, Proteintech, 15044-1-AP, 1:100). AlexaFluor-conjugated secondary antibodies (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Malcolm J. W. Sim, et al.,
bioRxiv - Immunology 2019
Quote:
... and KIR2DL1/S1 (EB6, Beckman Coulter, A22332).
-
No products found
because this supplier's products are not listed.
Jamin Liu, et al.,
bioRxiv - Microbiology 2022
Quote:
... 293T cells were transfected with arenavirus glycoprotein expression plasmids using TransIT-LT1 (Mirus Bio). Cells were transduced the following day with VSV-ΔG-GFP (Kerafast)(45 ...
-
No products found
because this supplier's products are not listed.
Song-iee Han, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Myc tag (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... The putative S1 was microdissected using a Dissecting Scope (Leica, #M165FC) and incubated in 0.05% trypsin at 37°C for 5 minutes ...