-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
Kit consists of 500mL 4Z3-500 Medium, 5mL CultureBoost™ (containing animal derived growth...
Cat# 4Z3-500,
510.0 mL, $173.0
Ask
Wendelin Dailey, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The cell line was also subjected to short tandem repeat (STR) Profile Testing by Cell Systems at the Master Level (P1) ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
Nato3-LoxP mice was generated using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology by Applied StemCell, Inc ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Carlos Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... media in both apical and basal chambers was replaced by calcium-rich (1.2 mM) differentiation barrier medium (CnT-Prime-3D medium, CELLnTEC), designated day 0 ...
-
No products found
because this supplier's products are not listed.
Linnea C. Wethekam, Jeffrey K. Moore,
bioRxiv - Genetics 2023
Quote:
... was thawed from −80°C storage and transferred onto rich media + 50 µg/mL G418 with the Singer RoToR (Singer Instruments, Somerset, UK). Four ...
-
No products found
because this supplier's products are not listed.
Anthony Hung, et al.,
bioRxiv - Genomics 2021
Quote:
iPSC-chondrocytes were treated with a cyclic tensile strain regimen that is known to induce an OA-like phenotype using the Flexercell FX6000 Tension System (Flexcell International)23–26 ...
-
No products found
because this supplier's products are not listed.
Pamela O’Neill, et al.,
bioRxiv - Bioengineering 2023
Quote:
... ETE mAb LC and DTE mAb LC was quantified using Kappa and Lambda Human Immunoglobulin Free LC (FLC) ELISAs (BioVendor, UK) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yosef Fichman, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The resulting RbohD sequence without its regulatory domain was cloned into pCAMBIA2301 vectors (Marker Gene Technologies, Eugene, OR, USA) downstream of the native RbohD promoter (Nühse et al. ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
A. Rahman, et al.,
bioRxiv - Immunology 2019
Quote:
... Lysates (containing protein at 6mg/mL) from four donors were pooled prior to Kinex antibody microarray analysis (Kinexus Bioinformatics) (H ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... ELISA and immunoblot antibodies were validated using species-specific positive (purified species-specific protein; Haematologic Technologies, Inc, Essex Juntion, VT) and non-specific protein negative controls ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... with protein ladder (Gel Company FPL-008). Gels were imaged with a Sapphire molecular imager (Azure Biosystems ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
Cat# 36838-63-8,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Verica Vasić, et al.,
bioRxiv - Neuroscience 2022
Quote:
... As primary antibody a polyclonal rabbit anti-human EGFL7 antibody (1:50, ReliaTech GmbH) was applied ...
-
No products found
because this supplier's products are not listed.
Víctor M. Hernández-Rocamora, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The protein was labelled with Dy647-maleimide probe (Dyomics, Germany) following instructions from the manufacturer ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and IV Fc chimera proteins were produced by Molecular Innovations. His-tagged recombinant human tau variants 2N4R ...
-
No products found
because this supplier's products are not listed.
Tomasz M. Grzywa, et al.,
bioRxiv - Immunology 2021
Quote:
... Anti-DNP antibodies (Life Diagnostics, Inc) at concentration 1 U/ml were used for overnight incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
Proteins were separated on 4-20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Fabian Braun, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... was diluted with antibody diluent (Medac-diagnostica, Germany) 1:1000 and developed using poly-HRP-anti mouse/rabbit IgG (Bright Vision ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...
-
No products found
because this supplier's products are not listed.
Hagit Hak, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and images of protein bands were acquired and quantified using the Alliance Q9 software (UVITEC).
-
No products found
because this supplier's products are not listed.
Elva Vidya, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Two mg of proteins were used in four rounds of rabbit injection (Capralogics, Cambridge Massachusetts) and a total of three bleeds were collected and characterized.
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Jie Hu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Total protein was extracted from cells using radio immunoprecipitation assay Lysis Buffer (CoWin Biosciences, Beijing, China) containing 1 mM phenylmethylsulfonyl fluoride (Beyotime ...
-
No products found
because this supplier's products are not listed.
Elsa Mazari-Arrighi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... rabbit anti-rat albumin antibody (RaRa/ALB/7S, Nordic-MUbio, Netherlands) was used as primary antibody and biotinylated goat anti-rabbit antibody (VECTASTAIN Elite ABC HRP Kit ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...