1 - 44 of 44
suppliers found for
Leptin SAP
» view 635 matched products-
Advanced Targeting Systems Sponsored
Leptin-SAP is a chemical conjugate of the recombinant mouse leptin and the ribosome-inactivating...Cat# IT-47-25, 25.0 micrograms, USD $375.0 Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... 0.5 µl of SAP (Affymetrix), 0.1 µl E ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Clinical Trials 2018Quote: ... leptin and neopterin by 125I-radioimmunoassay (Leptin: Millipore, MA ... -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: ... leptin (mouse leptin ELISA, Crystal Chem); and adiponectin (mouse adiponectin ELISA ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... and SAP (NEB, M0371S) treatment ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018Quote: ... Plasma leptin and adiponectin levels were determined with a mouse leptin ELISA kit (R&D Systems, Minneapolis, USA) and a mouse adiponectin ELISA kit (Otsuka Pharmaceutical Co. ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in PLOS Biology doi: 10.1371/journal.pbio.3000296Quote: Leptin (3 mg/kg; Peprotech) was injected intraperitoneally in P14 pups ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: Plasma levels of adiponectin and leptin were measured using commercially available kits (Human Leptin Enzyme Immunoassay, Merck, Cat ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... and leptin (#ab100718, Abcam, Cambridge ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... Circulating leptin (ALPCO, Salem, NH, USA) was measured from plasma samples ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in eLife doi: 10.7554/eLife.52539Quote: ... anti-SAP (Rat, 1A9, Biolegend), anti-β actin (Mouse ... -
Advanced Targeting Systems
Leptin-SAP is a chemical conjugate of the recombinant mouse leptin and the ribosome-inactivating...Cat# IT-47-25, 25.0 micrograms, USD $375.0 AskbioRxiv - Immunology 2020Quote: ... non-interaction of these two components was ensured by using non-biotinylated antibodies and sAV-SAP whose biotin-binding sites were occupied by an irrelevant biotinylated 11-mer peptide (BLANK Streptavidin-SAP, Advanced Targeting Systems). For experiments in which free antibody or sAV-SAP were administered alone ... -
Assay Pro
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: ... Leptin ELISA (ASSAYPRO, CliniSciences S.A.S. ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Journal of Clinical Oncology doi: 10.1200/JCO.2019.37.7_suppl.554Quote: ... Primary antibodies to leptin (dilution 1:100; SC-842, SANTA CRUZ, Dallas, TX, USA), adiponectin (dilution 1:100 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... pLE1-firefly luciferase was generated by cloning 115bp leptin enhancer 1(LE1)(GAGAACACTTAACAGCAAAGGTTAATCTTTGAAGTCCCTAAAGATTTGAACTTTCCGCAGAATTGGCTGCAGCGTCTAGTGGGTTAGAGTCTAATTGGAGTAGAGCAGAAGCAAG) into pGL4.27 (Promega) between XhoI and HindIII sites ... -
Biomatik Corporation
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... Levels of leptin and TNF-α were determined in undiluted samples using the Leptin mouse ELISA kit (Biomatik, EKB01861) and the TNF-α mouse ELISA kit (Biomatik ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019, published in PLOS ONE doi: 10.1371/journal.pone.0220539Quote: ... The amplicons were purified using ExoI-SAP (GE Healthcare) and directly sequenced in a MegaBACETM500 (GE Healthcare) ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... 50 μl unprocessed xylem sap were transferred to a 2 mL reaction tube (Eppendorf) and 200 μL extraction medium (methanol ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... Leptin-luciferase reporter BACs were used to generate transgenic animals in the inbred FVB N/J background (Jackson Lab) using common pronuclear injection techniques (17 ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: Adult mice heterozygous (Ob/+) for the leptin spontaneous mutation Lepob were initially obtained from Charles River (JAX™ mice strain) and interbred to obtain a colony ... -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Fitzgerald
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Purified human SAP (30C-CP1104LY) was purchased from Fitzgerald Industries (Acton ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... SHP1 and SAP were purchased from QIAGEN (Hilden, Germany) (siSLAMF6(1 ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: ... The xylem sap was filtered through Vivaspin 15R centrifugal concentrators (Sartorius) and directly used as medium for inoculation. -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... leptin (twice/day for 2 days at 0.25 mg/kg, Tocris), AM251 (3 mg/kg ... -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in International Journal for Parasitology: Parasites and Wildlife doi: 10.1016/j.ijppaw.2019.07.004Quote: All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: Mice were submitted to 24 h of fasting and then received ip injections with either saline (0.9% NaCl) or mouse recombinant leptin (5 mg/kg body weight, Calbiochem, Billerica, MA, USA) immediately before the dark cycle ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... CyRFP excised with NheI and NotI from pCAG-CyRFP was blunted with SAP (Takara: 2660A) and Klenow (Takara ... -
Peptides International
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... half of the colonoids were stimulated with 100ng/ml of PEGylated leptin (Peptides International, KY) added to media 3 times weekly ... -
Arbor Assays
No products foundCited in Individual housing of male C57BL/6J mice after weaning impairs growth and predisposes for obesitybioRxiv - Physiology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0225488Quote: ... leptin and insulin were analyzed by commercial ELISA’s according to manufacturer’s instructions (EIA CORT kit, Arbor Assays, Michigan ... -
Bachem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Leptin was obtained from the National Hormone and Peptide Program (Dr. A. F. Parlow) and SHU9119 from Bachem. -
Targeting Systems
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: One μl of anti-melanopsin conjugated with saporin (Melanopsin-SAP, 400 μg/ml, Advance Targeting System, San Diego, CA) was injected into the vitreous of the right eye of Tbr2TauGFP/+ mice using a 33-gauge NanoFil system (World Precision Instruments ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018, published in PLOS Pathogens doi: 10.1371/journal.ppat.1008144Quote: ... pMiG-empty or pMiG-SAP plasmids were co-transfected with PsiEco helper plasmid into Phoenix 293T cells using Fugene 6 (Roche) according to standard procedures [79] ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in eLife doi: 10.7554/eLife.35786Quote: ... For further sympathetic neuron differentiation d12 SAP cells were switched into a medium containing BrainPhys neuronal medium (Stem Cell Technologies), 1× B27 supplement (Thermo Fisher) ... -
Lonza
No products found because this supplier's products are not listed.Cited in Mesoscale Dynamics of Spectrin and Acto-Myosin shape Membrane Territories during MechanoresponsebioRxiv - Cell Biology 2019Quote: Immortalized mouse embryonic fibroblasts (MEFs) derived from RPTP α+/+ murine background (Su, Muranjan and Sap, 1999) were grown in complete media composed by DMEM (Lonza) supplemented with 10% Fetal Bovine Serum South American (FBS SA ... -
Carl Zeiss
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... The contrast sensitivity at several locations of the VF was measured using SAP in particular HFA (Carl Zeiss Meditec, Jena, Germany) using the 24-2 or 30-2 grid and the Swedish Interactive Threshold Algorithm (SITA ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... After this anti-rabbit IgG secondary antibody (for Sap and EA1) or anti-mouse IgG secondary antibody (for BslO) conjugated with horseradish peroxide (1:10,000 - Cell Signaling Technology) was used and the blots were incubated for another 60 min ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Cell doi: 10.1016/j.cell.2020.03.062Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pathology 2018Quote: ... The filtered sap inoculum was then added to adherent leafhopper cell cultures at 1 mL per 25 cm2 flask (Corning®, Inc), and let stand for 10 minutes ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... Fifty μl xylem sap and 50 μl Coomassie Plus were mixed in a flat bottom 96 well micro titer plate (Greiner AG, Kremsmünster, Austria) and incubated for 10 min at room temperature ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... Tables S1 and S3) and their CWD status was independently identified utilizing the Bio-Rad TeSeE Short Assay Protocol (SAP) Combo Kit (BioRad Laboratories Inc., Hercules, CA, USA). Positive RPLNs were confirmed by IHC at the Colorado State University Veterinary Diagnostic Laboratory (CSU VDL) ... -
MedChemExpress
Cat# HY-P70704-50 μg, 50 μg, USD $50.0No citation found on bioRxiv -
Abbexa Ltd.
Cat# abx263119, 100 µg, USD $290.0No citation found on bioRxiv -
Cohesion Biosciences
Rabbit polyclonal antibody to LeptinCat# CPA6011, 200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0No citation found on bioRxiv -
Creative Biomart
Recombinant Human LEPR (NP_002294.2) extracellular domain (Met 1-Asp 839), fused with a...Cat# LEPR-3160H, 100.0 µg, USD $429.0No citation found on bioRxiv