-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... and IPTG (99%) from Omega Scientific (Tarzana, CA).
-
No products found
because this supplier's products are not listed.
Barbara Mair, et al.,
bioRxiv - Genomics 2019
Quote:
... 1.982g/L glucose and 0.161g/L L-glutamine (Wisent Bioproducts) with 10% FBS (Gibco ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikolajczyk, et al.,
bioRxiv - Biochemistry 2021
Quote:
2 × 104 CHO-Lec2 cells were seeded in 96-well plates (Wuxi NEST Biotechnology Co., Ltd, China) in complete DMEM/F12 ...
-
No products found
because this supplier's products are not listed.
Samuele Cancellieri, et al.,
bioRxiv - Genetics 2021
Quote:
... and 100 ng ml-1 recombinant human FMS-like Tyrosine Kinase 3 Ligand (Flt3-L) (CellGenix cat# 1415-050). HSPCs were electroporated with 3xNLS-SpCas9:sg1617 RNP or HiFi-3xNLS-SpCas9:sg1617 RNP 24 h after thawing ...
-
No products found
because this supplier's products are not listed.
Sandor Spisak, et al.,
bioRxiv - Cancer Biology 2024
Quote:
(Cellecta #SVSHU6TEP-L-CT) was used for shRNA inducible knockdown in colon organoids ...
-
No products found
because this supplier's products are not listed.
Ved Mehta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Precipitated sodium deoxycholate was removed by filtering through a Corning® 2 µM PVDF plate and samples were further desalted on a 96-well MacroSpin plate (The Nest Group). Peptides were eluted with 80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
NG Tolman, et al.,
bioRxiv - Genetics 2020
Quote:
... mice were acclimatized to the procedure room and anesthetized via an intraperitoneal injection of a mixture of ketamine (99 mg/kg; Ketlar, Parke-Davis, Paramus, NJ) and xylazine (9 mg/kg; Rompun, Phoenix Pharmaceutical, St. Joseph, MO) immediately prior to IOP assessment ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... and kept in the CO2 (37°C and 5%CO2/95% air atmosphere) for 24 hours in the DMEM (ATCC, LGC Standards) supplemented with 10% FBS ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Winifred P.S. Wong, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... C57BL/6N mice were exposed to either vehicle or 0.5mM (=56.2ppm Cd, 56.2 mg/L Cd) or 1mM CdCl2 (112.4ppm Cd, 112.4 mg/L Cd) (Rigaku, Cat #: 1008154) in deionized drinking water (18.2µΩ ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Lin, et al.,
bioRxiv - Biophysics 2023
Quote:
... and hand-packing into a column (2 mm ID × 2 cm, IDEX C-130B). After digestion ...
-
No products found
because this supplier's products are not listed.
Takuma Komori, et al.,
bioRxiv - Cell Biology 2022
Quote:
... genomic DNA was directly extracted from single cell clones in 96-well plates using DNAzol Direct (Molecular Research Center) and subjected to PCR for the detection of both WT and the deleted alleles using appropriate primers ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Leah M. Williams, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a piece of tissue approximately 2 cm by 2 cm was placed into a glass dounce tissue grinder (Wheaton USA) with 1 ml of AT Lysis Buffer and protease inhibitors (described above) ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Ben-Jie Li, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 95%) were purchased from TargetMol (Shanghai, China). The other chemicals used in this research were purchased from Sigma-Aldrich except with special instructions.
-
No products found
because this supplier's products are not listed.
Sabrina I. Green, et al.,
bioRxiv - Microbiology 2020
Quote:
Clear-walled Immulon 2 HB 96-well microtiter plate (Immunochemistry Technologies #227) were used for the ELISA assays ...
-
No products found
because this supplier's products are not listed.
Alice E. Stanton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in which 3 mmol/L thiol-reactive groups of 2000 kDa Dextran-VS (Nanocs) or TRUE dextran (Sigma ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Rasmussen, et al.,
bioRxiv - Biochemistry 2022
Quote:
... placed in 96-well culture blocks (Costar 3961 Assay block, 2 mL, 96 well standard,) covered in Breathe-EASIER covers (Diversified Biotech, cat. # BERM-2000,) and grown by shaking at 1000 RPM and 37 °C for the indicated times in a Vortemp shaker for cellular assays.
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Xien Yu Chua, Arthur Salomon,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM L-Glutamine (HyClone) and 10% (v/v) heat-inactivated fetal bovine serum (Peak Serum), in a humidified incubator with 5% CO2 at 37°C ...
-
No products found
because this supplier's products are not listed.
Mizuki Honda, et al.,
bioRxiv - Genomics 2020
Quote:
NPOM-caged dT-CE phosphoramidite was purchased from Glen Research (10-1534-95) and used to synthesize caged ODNs with OPC-grade purification by Nihon Gene Research Laboratory.
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Anna-Maria Möller, et al.,
bioRxiv - Microbiology 2023
Quote:
... L-161,240 (AdooQ), BB-78485 (Aobius) ...
-
No products found
because this supplier's products are not listed.
Hirak Saxena, et al.,
bioRxiv - Microbiology 2023
Quote:
All strains were grown in 2YT media (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, BioShop Canada). NEB® Stable E ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Heng Lin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HEK cells were transfected with 2-3 μg of the designated construct or empty vector using the PolyJet (SignaGen Laboratories, SL100688).
-
No products found
because this supplier's products are not listed.
Felix Flomm, et al.,
bioRxiv - Microbiology 2019
Quote:
... the discs were washed in >99% Ethanol (Roth) twice by sonication for 10 minutes each and plasma cleaned in a Quorum Q150 plus (Quorum Technologies Ltd, UK) machine for 120 seconds and subsequently coated with a thin film of carbon through carbon cord evaporation ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Jordan P. Lewandowski, et al.,
bioRxiv - Immunology 2019
Quote:
... compressed 2” x 2” cotton nestlet (Ancare), and a mouse hut (BioServ) ...
-
No products found
because this supplier's products are not listed.
Debra J. Skinner, Trang Dang, Charles S. Gasser,
bioRxiv - Plant Biology 2022
Quote:
... and library preparation with Nextflex-96 indexes (Bioo Scientific, Austin, TX).
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Lucas D. Caeiro, et al.,
bioRxiv - Cancer Biology 2023
Quote:
%5-mC was quantified using a commercially available ELISA (Epigentek, #P-1030-96), as per the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Philipp Jung, et al.,
bioRxiv - Biophysics 2021
Quote:
... The following antibodies or reagents were used: anti-Integrin alpha-L (ITGAL) antibody (Antibodies-online), mouse anti-human CD28 antibody (BD Pharmingen) ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Barbara Summers, et al.,
bioRxiv - Pathology 2023
Quote:
... and anti-collagen I and II in mouse BAL was done using a commercially available ELISA on a 96-well plate (Chondrex) and a plate reader ...