-
No products found
because this supplier's products are not listed.
François Boudsocq, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The ParAF and ParBF preparations were pure to > 97% homogeneity as judged by SDS-PAGE stained by Instant Blue (Euromedex). An example of ParAF purification was shown in Supplementary Figure S1A.
-
No products found
because this supplier's products are not listed.
Tony Ngo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The percentage of cells infected by virus was quantified by flow cytometry following staining of 10 µL of cells with 10 µL of PE-conjugated anti-gp64 antibody (Expression Systems, catalog #97-201) for 20 min in the dark at 4°C ...
-
No products found
because this supplier's products are not listed.
Pushan Bag, et al.,
bioRxiv - Plant Biology 2022
Quote:
... H218O (97%; Larodan Fine Chemicals AB) was added (final enrichment of 10%) ...
-
No products found
because this supplier's products are not listed.
Hang Gyeong Chin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... >97% purified porcine tubulin (rPeptide, # T-1201-1) and >99% purified bovine tubulin (MP-Bioscience ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Ruben Shrestha, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and sec seedlings were grown on Hoagland medium containing 14N or 15N isotope salt (1.34 g/L Hoagland’s No. 2 salt mixture without nitrogen (Caisson labs), 6 g/L Phytoblend ...
-
No products found
because this supplier's products are not listed.
Karine Queiroz Zetune Villa Real, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Fluorescent NbSyt1 was incubated with different dilutions of purified Syt-1(97-421) using Premium Coated Capillaries (NanoTemper). For operation of the instrument and evaluation of affinity data ...
-
No products found
because this supplier's products are not listed.
Daric J. Wible, et al.,
bioRxiv - Cell Biology 2023
Quote:
Cells were labeled with 0.2 μCi/mL L-valine [14C(U)] (MC-277, Moravek Biochemicals, Brea, CA) overnight ...
-
No products found
because this supplier's products are not listed.
Benjamin Murray Heineike, Hana El-Samad,
bioRxiv - Evolutionary Biology 2019
Quote:
... 96 well glass-bottom plates (Brooks Life Science Systems MGB096-1-2-LG-L) were prepared for imaging by coating with 0.25mg/ml concanavalin A (Sigma-Aldrich C2010 ...
-
No products found
because this supplier's products are not listed.
Anne Rix, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... followed by donkey F(ab’)2 anti-rabbit IgG (H+L)-Cy3 (3 μg/mL) (Dianova) [26] ...
-
No products found
because this supplier's products are not listed.
Hao Guo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... serial dilutions (df = 2) of standards for lanosterol (Biomol (Hamburg Germany, purity >95%), zymosterol (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Victor Ruiz-Rodado, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and A18110101 (L-amino acid diet with 2 g L-cysteine and 2 g L-cystine per kg) from Research Diets Inc ...
-
LC Laboratories' Product Number S-9344 - Stauprimide (N-Benzoyl-7-oxostaurosporine, CAS...
Cat# S-9344, SKU# S-9344_100mg,
100 mg, $998.00
Ask
Tanja Sack, et al.,
bioRxiv - Biochemistry 2023
Quote:
Doxorubicin hydrochloride salt (purity >99%) (LC Laboratories) was dissolved in DMSO (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Vincent A. Bielinski, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2 L of bacterial culture (Super Broth, Teknova) supplemented with 50 μg ml−1 kanamycin ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Bryan Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... Fixed biofilms were washed twice in PBS and dehydrated through a series of 60-min ethanol washes (25%, 50%, 70%, 95%, 3 × 100% ethanol) and cleared via three 60-min incubations in Histoclear-II (National Diagnostics); these steps were performed using an STP120 Tissue Processor (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Maria G. Noval, et al.,
bioRxiv - Microbiology 2020
Quote:
... 90-95% confluent T175 flask (Thomas Scientific) of Vero E6 (1×107 cells ...
-
No products found
because this supplier's products are not listed.
Swapnil Rohidas Shinde, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 2 mM L-glutamine (400-106; Gemini Bio-products). The RPE1-hTERT cell line (ATCC CRL-4000 ...
-
No products found
because this supplier's products are not listed.
Taylor Anthony Stevens, et al.,
bioRxiv - Biochemistry 2023
Quote:
... vented cap (2 L roller bottle; Celltreat, cat. no. 229385)
-
No products found
because this supplier's products are not listed.
Súil Collins, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Synthetic Aβ42 (>95%, Eurogenentec) and Aβ42 Hilyte™ Fluor 488 (>95%, labelled at the N-terminus) were purchased from Anaspec as lyophilised powder ...
-
No products found
because this supplier's products are not listed.
Manjing Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... and dried down completely under nitrogen stream at 30 L/min (top) 1 L/min (bottom) at 30°C (Biotage SPE Dry 96 Dual; 3579M). To dried samples ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Angela Rocio Ortiz Camargo, et al.,
bioRxiv - Microbiology 2022
Quote:
... Afterwards the peptides were eluted at 100 nL/min in a 90 minutes extended gradient from 10-40% acetic acid solvent (in 95% acetonitrile) to a 20-cm IntegraFrit column (50 μm inner diameter, Reprosil-Pur C18-AQ 3 μm, New Objective, Woburn, USA). The acquired spectra were analyzed using Thermo Proteome Discoverer in combination with Mascot (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... L-α-[myo-inositol-2-3H(N)] (ART 0184, American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Celia Municio, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-CAP-D2 serum (1:1000) or rabbit anti-GFP conjugated with Alexa488 (1:1000, Chromotek, PABG1). And then with secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Kevin C. Allan, et al.,
bioRxiv - Developmental Biology 2022
Quote:
96-well plates with parallel-aligned 2-4 μm electrospun fibers (AMS.TECL-005-8X, AMSBio) were washed with 70% ethanol followed by coating with PO for at least 1 hour at 37°C and laminin for at least 3 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Sebastian Boland, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or naked-beads (Echelon Biosciences Cat#P-BLBP-2 Cat#L-6101 Cat#P-B000) for 3 hours on a rotator ...
-
No products found
because this supplier's products are not listed.
Bas MJ Olthof, et al.,
bioRxiv - Neuroscience 2021
Quote:
... animals received a bolus injection of salicylate at 0 h and from 2-4 h the microdialysis probe was perfused with L-methyl arginine (Cambridge Bioscience; L-MeArg, 500 µM in aCSF) - a concentration previously shown to effectively inhibit nNOS in vivo (Garthwaite et al. ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Su, et al.,
bioRxiv - Microbiology 2021
Quote:
... Full length RNase L gene was synthesized and subcloned into pGEX-4T-3 vector (pGEX-4T-RNaseL-GST) by GENEWIZ as previously described (27).
-
No products found
because this supplier's products are not listed.
Niclas Heidelberg Lyndby, et al.,
bioRxiv - Biophysics 2023
Quote:
A tank with ∼10 L of deionized water was placed on top of 3 magnet stirrers (RCT basic, IKA GmbH). A heater and a small water pump were fitted in the bath to keep water homogenously at 25(±0.5)°C ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Sneha Kumari, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Cell culture grade dimethyl sulfoxide (DMSO) and histological grade ethanol (95%) were purchased from Bioworld. Deep blue cell viability kit was purchased from Biolegend ...
-
No products found
because this supplier's products are not listed.
Kathryn Jane Turnbull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
No products found
because this supplier's products are not listed.
Noriyoshi Mizuno, et al.,
bioRxiv - Genomics 2019
Quote:
... for 120 min at 37 °C and measured by the Boyden chamber method with a 96-well micro-chemotaxis chamber containing a 3-µm pore-sized filter (CELL BIOLABS, INC., San Diego, CA, USA).
-
No products found
because this supplier's products are not listed.
Sapan Borah, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1.25% SP complete supplements (adenine hemisulfate, L-histidine hydrochloride monohydrate, L-leucine, L-lysine hydrochloride and uracil) from Sunrise Science products, at 30°C ...
-
No products found
because this supplier's products are not listed.
Francisco Santos, et al.,
bioRxiv - Cell Biology 2024
Quote:
... for 5 min at 95°C in the presence of 50 mM DTT and protein standard (NZYTech, MB09002) was used ...
-
No products found
because this supplier's products are not listed.
Yfat Yahalom-Ronen, et al.,
bioRxiv - Microbiology 2020
Quote:
... L and G proteins (Kerafast), all of which under T7 promoter control ...
-
No products found
because this supplier's products are not listed.
Jianfeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the 96-well former of the upper portion of a CometChip 96-well former cassette (donated by Trevigen), was hollowed out and was replaced with a bottomless 384-well plate (Greiner Bio-One ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Bradley Ward, et al.,
bioRxiv - Systems Biology 2024
Quote:
... are added and the mixture is vortexed briefly (max power, 3 seconds, Vortex-Genie 2, Scientific Industries, Bohemia, United States) and spun down (3 seconds ...
-
No products found
because this supplier's products are not listed.
Michael Devos, et al.,
bioRxiv - Immunology 2020
Quote:
... the beads were resuspended in 1X Laemmli buffer and incubated at 95°C for 5 min Primary antibodies used in this study are anti-ZBP1 (Adipogen, Zippy-1), anti-RIPK1 (CST ...
-
No products found
because this supplier's products are not listed.
Jacek M. Kwiecien, et al.,
bioRxiv - Pathology 2019
Quote:
... and light chain of neurofilament (NF-L) (MyBioSource) were used to measure the levels of these proteins in the serum samples from the SCI rats according to the supplier ...
-
No products found
because this supplier's products are not listed.
Jo E Lewis, et al.,
bioRxiv - Physiology 2021
Quote:
... were food restricted to maintain 95% body weight for two weeks prior to training and testing in standard mouse Bussey-Saksida touchscreen chambers (Campden Instruments Ltd, Loughborough, UK). Training and testing procedures were conducted as previously described 62 ...