-
No products found
because this supplier's products are not listed.
Kyle Swovick, et al.,
bioRxiv - Systems Biology 2020
Quote:
... supplemented with L-arginine:HCl (13C6, 99%) and L-lysine:2HCl (13C6, 99%;Cambridge Isotope Laboratories) at concentrations of 0.13 g/l and 0.0904 g/l respectively ...
-
No products found
because this supplier's products are not listed.
Roland C. Wilhelm, et al.,
bioRxiv - Microbiology 2022
Quote:
... ring-labelled vanillin (99% atom % 13C6 + 1.1% atom % 13C2; Sigma Isotec) and bacterial cellulose (∼99 atom % C ...
-
No products found
because this supplier's products are not listed.
Chloé Colas, et al.,
bioRxiv - Immunology 2022
Quote:
... human recombinant Fms-related tyrosine kinase 3 ligand (FLT3-L) (PeproTech) until injection in mice (within 3 to 6 hours of culture ...
-
No products found
because this supplier's products are not listed.
Alina Vulpe, Pratyajit Mohapatra, Karen Menuz,
bioRxiv - Neuroscience 2021
Quote:
... 1-hexanol (99%, ACROS Organics, CAS 111-27-3), 2-oxovaleric acid (>98% ...
-
No products found
because this supplier's products are not listed.
Dominik P. Elmer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
No products found
because this supplier's products are not listed.
Jasmine Nayak, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... protein adduct formation and anti-3-nitro-tyrosine(ab110282, Mouse, Abcam) were also studied by western blotting ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Stefan Kotschi, et al.,
bioRxiv - Biochemistry 2021
Quote:
... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
No products found
because this supplier's products are not listed.
Sigrid Wahlen, et al.,
bioRxiv - Immunology 2022
Quote:
... FMS-like tyrosine kinase-3 ligand (FLT3-L) (100 ng/mL, R&D systems) and thrombopoietin (TPO ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Allen Sam Titus, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... procaspase-3 and Phospho-tyrosine were from Santa Cruz Biotechnology (Dallas ...
-
No products found
because this supplier's products are not listed.
Phillip Zhu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
No products found
because this supplier's products are not listed.
Nadine Honke, et al.,
bioRxiv - Immunology 2020
Quote:
... and 3-Iodo-L-tyrosine-treated B cells were labeled by using the Annexin V Fitc Apoptosis detection kit (BD, Heidelberg, Germany) according to manufacturer`s instructions ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Nishiji, et al.,
bioRxiv - Cell Biology 2023
Quote:
... sonicated 3 × 30 s (power: middle, Bioruptor Plus, Diagenode) and then centrifuged at 16000 g for 15 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Abdullah O. Khan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... recombinant Fms-like tyrosine kinase-3 (Flt3, StemCell Technologies Cat#78009), Erythropoeitin (EPO ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
No products found
because this supplier's products are not listed.
Manuela Mengozzi, et al.,
bioRxiv - Genomics 2019
Quote:
... vitamin D2 (1,25-dihydroxyvitamin D2; Cayman Chemical) or vitamin D3 (1,25-dihydroxyvitamin D3 ...
-
No products found
because this supplier's products are not listed.
Yehudi Bloch, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Purified mIL-12bC197S-His6 in complex with mIL-12Rβ1D1-D2-His6 was subjected to an overnight Caspase-3 and EndoH (New England Biolabs) digest (1/100 w/w ...
-
No products found
because this supplier's products are not listed.
Stefan Radtke, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and FLT3-L (Fms-related tyrosine kinase 3 ligand; Miltenyi Biotec). Cells were cultured at 37°C ...
-
No products found
because this supplier's products are not listed.
Lilian Schimmel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-cleaved caspase 3 (Cell Signaling, 9661 IF1:30 after pre-labeling), rabbit anti-GAPDH (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Santiago Solé-Domènech, et al.,
bioRxiv - Biochemistry 2024
Quote:
... and 50 mM H2O2 (VWR, 30% aqueous stock, BDH7690-3) were prepared in ultra-pure water and immediately added to the fluorophore aliquots to a final concentration of 100 or 200 µM ...
-
No products found
because this supplier's products are not listed.
Yujung Michelle Lee, et al.,
bioRxiv - Physiology 2020
Quote:
... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
No products found
because this supplier's products are not listed.
Peyton J. Tebon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... To generate larger rings (maxi-rings) in 24-well plates (Corning 3527), 70μL of cell suspension (1.4×106 cells/mL ...
-
No products found
because this supplier's products are not listed.
Dennis Lapuente, et al.,
bioRxiv - Immunology 2021
Quote:
... mice were injected with 3 µg anti-CD45-BV510 (clone 30-F11, Biolegend) intravenously and were euthanized three minutes later with an overdose of inhaled isoflurane ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ...
-
No products found
because this supplier's products are not listed.
Sasimonthakan Tanarsuwongkul, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and (Z)-3-hexenyl acetate (Z3-HAC, 99%; Alfa Aesar) were solved in ethanol (100% ...
-
No products found
because this supplier's products are not listed.
Feng Chi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were loaded into each well of a 384-well plate (A1 through D2) and dispensed 50nL per well into a 5,184 well SMARTer™ ICELL8® 3’ DE Chip (Takara Bio) using the ICELL8® Multisample NanoDispenser (MSND ...
-
No products found
because this supplier's products are not listed.
Tomonari Matsuda, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 (Illumina).
-
No products found
because this supplier's products are not listed.
Alejandro Gella, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Bartlomiej Remlein, Bryce M. Paschal,
bioRxiv - Cell Biology 2020
Quote:
... AffiniPure Donkey Anti-Rabbit IgG (H+L) conjugated with Cyanine Cy™3 (Jackson Immunoresearch), Alexa Fluor 680® Donkey anti-Rabbit IgG (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Abhinav K. Maurya, et al.,
bioRxiv - Plant Biology 2019
Quote:
... cis-3-hexenyl acetate (99%) (CAS: 3681-71-8; TCI America), and trans-2-hexenal 98% ...
-
No products found
because this supplier's products are not listed.
Yongchan Lee, et al.,
bioRxiv - Biochemistry 2021
Quote:
... L-[3H]tyrosine (10 Ci/mol; PerkinElmer) and L-[3H]alanine (5 Ci/mol ...
-
No products found
because this supplier's products are not listed.
Angela M. Araujo, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The chromogen was 3-30-diaminobenzidine (Vector Laboratories). Nuclei were counterstained with Harris haematoxylin for 1 min ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
No products found
because this supplier's products are not listed.
Matthew Denholtz, et al.,
bioRxiv - Genomics 2019
Quote:
... cells were washed 3×3 minute in PBS and fixed for 30 minutes in 6% paraformaldehyde (Electron Microscopy Sciences 15710) in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Coralite594-conjugate goat anti-mouse IgG(H+L) (Proteintech, SA00013-3), Coralite488-conjugate goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Abhishek Bhattacherjee, et al.,
bioRxiv - Immunology 2021
Quote:
... the pellet was dissolved in 3 ml of 30% Percoll (Percoll PLUS, GE Healthcare) and carefully layered on top of 70% Percoll and immediately centrifuged (650 rcf for 20 min) ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Samples were homogenized 3 x 30s at 7000 power in a MagnaLyzer® (Roche Diagnostics, Basel, Schweiz) and placed on ice for ∼1 minute between each homogenization ...
-
No products found
because this supplier's products are not listed.
J.T. Stieglitz, K.A. Potts, J.A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... O-methyl-L-tyrosine (Chem-Impex International), p-propargyloxy-L-phenylalanine (Iris Biotech) ...
-
No products found
because this supplier's products are not listed.
Yanxia Zhang, et al.,
bioRxiv - Plant Biology 2023
Quote:
... a StrataX 30 mg/3 mL spe-column (Phenomenex) was used.
-
A component of the Papain Dissociation System. This material is 0.22 micron membrane filtered...
Cat# LK003172,
5 vi, $92.00
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Sangeeta Goswami, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′-3-diaminobenzidine (DAB) substrate (Leica Microsystems) was used as a chromogen followed by hematoxylin counterstain ...
-
No products found
because this supplier's products are not listed.
Xin Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... + 2.5% cAMP-d2 conjugate (Cisbio). The plate was incubated in the dark for 60 min at room temperature (∼22 °C ...
-
No products found
because this supplier's products are not listed.
Alexandra Paul, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Calu-3 cells were maintained in EMEM (with EBSS and L-glutamine, BioWhittaker, Lonza) supplemented with 20% FBS (heat-inactivated ...
-
No products found
because this supplier's products are not listed.
Karen E Hemmings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were treated with 5 μmol/L NucView™ 488 caspase-3 substrate (Biotium). Images were obtained in phase contrast and fluorescence mode using a x10 objective and an IncuCyte FLR time-lapse fluorescence microscope (Essen Bioscience) ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse anti-Caspase-8 (clone 5D3; RRID:AB_590761; 1g/L; MBL International Cat#M058-3), rat anti-human RIPK3 (clone 1H2 ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Nina Lautenschläger, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... OD620nm and luminescence were measured every 30 min in a plate reader (Cytation 3, BioTek). To detect luminescence ...
-
No products found
because this supplier's products are not listed.
Bianca M. Marcella, et al.,
bioRxiv - Physiology 2023
Quote:
DBA/2J (D2)-mdx (stock #001801) and D2 WT (stock #000671) were ordered from Jackson Laboratories at 5-6 weeks of age ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)