-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... D-Luciferin Potassium Salt (>99%) was purchased from Syd Labs. LY294002 ...
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Melissa Bredow, et al.,
bioRxiv - Plant Biology 2020
Quote:
AtPep1(99) and elf18 (100) used for immune assays were synthesized by EZBiolab (USA). AtPep1-induced SGI and ROS burst assays were performed as previously described (101) ...
-
No products found
because this supplier's products are not listed.
Motohiro Nonaka, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with human 15 N-terminal ANXA1 residues plus a cysteine residue at 16 position (MAMVSEFLKQAWFIEC) and L-MC16 mutants were synthesized by Bio-Synthesis (Lewisville, TX). IsodTIT7 ...
-
No products found
because this supplier's products are not listed.
Joana Saldida, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The third set of cultures contained a mixture of 80% unlabelled and 20% uniformly labelled [U-13C] glucose (Buchem, CLM-1396). From each flask ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Zibin Zhou, et al.,
bioRxiv - Biochemistry 2023
Quote:
... anti-pS/T (ECM Biosciences, PP2551, New Jersey, USA), anti-PKM2 (CST ...
-
No products found
because this supplier's products are not listed.
Yudong Guan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A2F N-glycan standards were obtained from QA-Bio. Two different batches of EPOs (epoetin beta ...
-
No products found
Alexander J. Ehrenberg, et al.,
bioRxiv - Pathology 2019
Quote:
... goat-anti-guinea pig IgG (H+L) – (R-05076, Advansta, or goat-anti-Rabbit IgG (H+L)-R-05072 ...
-
No products found
because this supplier's products are not listed.
Steven J. Hersch, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... we amplified the cassette by PCR using Taq (Froggabio T-500) or Q5 (NEB M0491 ...
-
No products found
because this supplier's products are not listed.
Samuel Lim, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... turbonuclease (Accelagen) and 1% n-Nonyl-Beta-D-Glucopyranoside (Cube Biotech) and shaken vigorously for 1 hour ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... LCA (100 μM final concentration) or T-LCA (100 μM final concentration, Steraloids) was then added into the media ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Ashley F. Melnick, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human and murine T-ALL cells were treated at increasing doses of berzosertib (Chemietek) for 9-10 days ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... with Ga (20 μg/L, Inorganic Ventures, Christiansburg, Virginia) as an internal standard ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... membranes were washed in PBS-T and were incubated with α-C1q (Complement Technologies, A200), α-C1r (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2024
Quote:
... membranes were washed with TBS-T and visualised using the LumiBlue ECL Extreme reagents (Expedeon) or Clarity Max Western ECL Substrate (Bio Rad ...
-
No products found
because this supplier's products are not listed.
Enrica Saponara, et al.,
bioRxiv - Physiology 2021
Quote:
... L-Type Triglycerol M (Wako Diagnostics, Enzyme Color R1 & R2), 96-well ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Anastassia Mikhailova, et al.,
bioRxiv - Microbiology 2020
Quote:
Activated CD4+ T cells were incubated with 6uM RT53-Rhodamine [Rhodamine-RQIKIWFQNRRMKWKKAKLNAEKLKDFKIRLQYFARGLQVYIRQLRLALQGKT] or RK16-Rhodamine [Rhodamine-RQIKIWFQNRRMKWKK] (Proteogenix) for 2 hours ...
-
No products found
because this supplier's products are not listed.
K.G. Daniels, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... T cells were cryopreserved in RPMI1640 (UCSF cell culture core) with 20% human AB serum (Valley Biomedical, #HP1022HI) and 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Hironari Nishizawa, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Ammonium bicarbonate (1 mol/L) for mass spectrometry was purchased from Cell Science & Technology Inst. ...
-
No products found
because this supplier's products are not listed.
Céline Petitgas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibodies used were mouse monoclonal anti-TH (1:1000, cat. n° 22941, ImmunoStar, Hudson, WI, USA) and mouse monoclonal anti-DA (1:100 ...
-
No products found
because this supplier's products are not listed.
Malwina Brożyna, et al.,
bioRxiv - Microbiology 2023
Quote:
The antimicrobial activity of T-EO or R-EO was assessed in 96-well plates (Wuxi Nest Biotechnology, China) in TSB (Tryptic Soy Broth ...
-
This kit is a simple convenient means of measuring free L-Carnitine in biological samples such as serum.
Cat# KITA1023,
Inquiry
Ask
Peter S. Chang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... supernatant was collected 24 hours after CAR-T and Raji-GFP/Luc cell (Creative Biogene, Cat. No: CSC-RR0320) co-culture (E:T=1:1) ...
-
No products found
because this supplier's products are not listed.
Aman Y. Husbands, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were washed three times with PBS-T and incubated with 1:2000 anti-His-tag antibody (Abiocode M0335-1) for 1h with gentle shaking at RT ...
-
No products found
because this supplier's products are not listed.
Lena Kleij, et al.,
bioRxiv - Microbiology 2023
Quote:
... and soybean L-α-phosphatidylinositol (PI) (37-0130-7) were purchased from Larodan (France). ANTS (FP-46574B ...
-
Recombinant AAV-2 VP1 Protein was expressed in E. coli.
Cat# VP1-1787A,
10ug , USD $298
Ask
Jason Garcia, et al.,
bioRxiv - Cancer Biology 2022
Quote:
LNCAP and 22Rv1 cells at 80% confluency were incubated with 25 nM T ± 125 nM human SHBG (SHBG-8259H, Creative BioMart) and 1 μM receptor-associated protein (MEG-Inh ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Caroline S. Cencer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CL4 and CACO-2BBE cells were grown to n days post-confluent (DPC) on acid-washed 22×22 mm #1.5H coverslips (Globe Scientific) in a 6-well plate to a time point with apical polarity representative of their native tissue ...
-
No products found
because this supplier's products are not listed.
Tawna L. Mangosh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Hybridization with 333ng/mL of a TelC-Cy5-labeled peptide nucleic acid (PNA) oligonucleotide telomere probe (N-CCTAACCTAACCTAA-C, PNA BIO) in PNA buffer (10mM Tris pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Prabhu S. Arunachalam, et al.,
bioRxiv - Immunology 2021
Quote:
... Alum (Alhydrogel 2%) was purchased from Croda Healthcare (Batch #0001610348) ...
-
No products found
because this supplier's products are not listed.
Ann Cirincione, et al.,
bioRxiv - Genomics 2024
Quote:
... pALD-VSV-G-A (2 μg, Aldevron), and the transfer vector (15 μg ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Marta Lopez-Nieto Jordana, et al.,
bioRxiv - Cell Biology 2023
Quote:
... expression levels of GADD34 in 2 control and 5 GADD34 KO single cell clones in response to 2 µM thapsigargin (Biotrend) treatment for 3 h was assessed by Western blotting ...
-
No products found
because this supplier's products are not listed.
T Feige, et al.,
bioRxiv - Cell Biology 2023
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2, Emfret Analytics) served as a platelet specific marker ...
-
No products found
because this supplier's products are not listed.
Wolfgang Knecht, et al.,
bioRxiv - Biochemistry 2023
Quote:
... supplemented with 50 µg/ml kanamycin in 2.5 L Full-Baffle Tunair Shake Flasks (IBI Scientific, Dubuque, Iowa, USA), with 1 L/flask ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The dissociated neurons were then plated onto 24-well plates with coverslips coated with poly-l-lysine (Newcomer Supply, 1339A) using minimum essential medium (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Xiangling Meng, et al.,
bioRxiv - Neuroscience 2022
Quote:
... hiPS cells (2 × 106 cells) dissociated with accutase (Innovative Cell Technologies, AT104) were electroporated using the P3 Primary Cell 4D-NucleofectorTMX Kit L (Lonza ...
-
No products found
because this supplier's products are not listed.
Jack A. Bryant, et al.,
bioRxiv - Microbiology 2023
Quote:
... Δskp and ΔdegP mutants were transformed with the EZ-Tn5™ 2> Tnp Transposome (Cambio) as previously described (Goodall et al. ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... and SARS-CoV-2 RNA was extracted using FavorPrep Viral RNA Minikit (FAVORGEN, Ping-Tung, Taiwan), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kazuya Toriumi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mRNA was purified from 2 μg of total RNA by NEXTflex poly(A) beads (Bioo Scientific, 512981), subjected to fragmentation and first and second strand syntheses ...