-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Farhan Ali, et al.,
bioRxiv - Neuroscience 2019
Quote:
... A bundle of stainless steel wires (3-4 wires per bundle) (790500, A-M Systems) was inserted into RSC ...
-
No products found
because this supplier's products are not listed.
Alessandro Bonadio, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 2 mM L-Alanyl-L-Glutamine (Caisson labs, GLL02), referred to hereafter as complete DMEM ...
-
No products found
because this supplier's products are not listed.
Anna-Maria Möller, et al.,
bioRxiv - Microbiology 2023
Quote:
... L-161,240 (AdooQ), BB-78485 (Aobius) ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Adar Sonn-Segev, et al.,
bioRxiv - Biophysics 2019
Quote:
... and the supernatant applied for 3 h at 4°C to 5 mL of Toyopearl AF-Chelate-650M resin (Tosoh) precharged with Ni2+-ions ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Stephen B. McHugh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were then incubated with primary antibodies diluted in 3% NDS blocking solution and incubated at 4 °C for 72 hours (GFP anti-chicken, 1:1,000, Aves Labs, catalog no ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Irene Fernández-Duran, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Sections were incubated with the primary antibody overnight at 4°C for Caspase 4/11 (bs-6858R, Bioss). Biotinylated secondary antibody was added and detected using the rabbit peroxidase ABC kit (Vector Laboratories ...
-
Poly-L-Ornithine comes with 5 mg of sterile powder. Poly-L-Ornithine is a synthetic amino acid...
Cat# 5172-5MG,
5 mg, USD $85.0
Ask
Rui Xu, et al.,
bioRxiv - Microbiology 2023
Quote:
... sporozoites were added to coverslips coated with poly-L-lysine (Advanced Biomatrix), fixed with 2% formaldehyde for 10 min and permeabilized and blocked with TSS buffer (DPBS containing 1% BSA and 0.1% Triton X-100 ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Dmitry Shvarev, et al.,
bioRxiv - Biochemistry 2023
Quote:
... ATTO488-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (ATTO488) was obtained from ATTO-TEC GmbH (Siegen ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... and IPTG (99%) from Omega Scientific (Tarzana, CA).
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Barbara Mair, et al.,
bioRxiv - Genomics 2019
Quote:
... 1.982g/L glucose and 0.161g/L L-glutamine (Wisent Bioproducts) with 10% FBS (Gibco ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Su, et al.,
bioRxiv - Microbiology 2021
Quote:
... Full length RNase L gene was synthesized and subcloned into pGEX-4T-3 vector (pGEX-4T-RNaseL-GST) by GENEWIZ as previously described (27).
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
No products found
because this supplier's products are not listed.
Sandor Spisak, et al.,
bioRxiv - Cancer Biology 2024
Quote:
(Cellecta #SVSHU6TEP-L-CT) was used for shRNA inducible knockdown in colon organoids ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
NG Tolman, et al.,
bioRxiv - Genetics 2020
Quote:
... mice were acclimatized to the procedure room and anesthetized via an intraperitoneal injection of a mixture of ketamine (99 mg/kg; Ketlar, Parke-Davis, Paramus, NJ) and xylazine (9 mg/kg; Rompun, Phoenix Pharmaceutical, St. Joseph, MO) immediately prior to IOP assessment ...
-
No products found
because this supplier's products are not listed.
Yingli Gu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 0.1% Poly-L- Lysine (Cultrex® Poly-L-Lysine) was from Trevigen (Gaithersburg, MD; Cat# 3438-100-01). Mouse NGF was purified from submaxillary glands as described previously94 ...
-
No products found
because this supplier's products are not listed.
Gwen Swinnen, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and 10 g/L of agar (Neogen) in Magenta boxes ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Katrina B. Velle, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were cultured axenically in M7 Media (10% FBS + 45 mg/L L-methionine + 5 g/L yeast extract + 5.4 g/L glucose + 2% (v/v) M7 Buffer (18.1 g/L KH2PO4 + 25 g/L Na2HPO4)) in plug seal tissue culture-treated flasks (CELLTREAT; cat. no. 229330) and grown at 28°C ...
-
No products found
because this supplier's products are not listed.
Manjing Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... and dried down completely under nitrogen stream at 30 L/min (top) 1 L/min (bottom) at 30°C (Biotage SPE Dry 96 Dual; 3579M). To dried samples ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (4) Spin-coating LOR3A photoresist (MicroChem) at 4000 rpm ...
-
No products found
because this supplier's products are not listed.
Alexis S Mobley, et al.,
bioRxiv - Immunology 2021
Quote:
... and APC-IL-4 (Tonbo Bioscience) for 30 minutes at 4◦C ...
-
No products found
because this supplier's products are not listed.
Farwa Sajadi, Jean-Paul Paluzzi,
bioRxiv - Physiology 2024
Quote:
... thus targeting both AedaeITP and AedaeITP-L (Biomatik, Kitchener, ON, Canada). Following incubation ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Christopher W Fell, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were washed once with PBS and incubated for 4 hours with 100µg/ml fluoresceinamine labelled glycosaminoglycans: 4-O-sulfated chondroitin sulphate (AMS.CSR-FACS-A1, AMSBIO), poly-sulphated chondroitin sulphate (AMS.CSR-FACS-P1 ...
-
No products found
because this supplier's products are not listed.
Irina Bregy, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Alexa Fluor® 488 goat anti-rat IgG (H+L)(Nanoprobes/FluoroNanogold) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 4 mL 5× PEG reagent (System Biosciences, LV825A-1) was added and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 50 nm gold particles (BBI Solutions, EM.GC50/4). Fixation was performed using a buffer made from ...
-
No products found
because this supplier's products are not listed.
Jordana Griffiths, et al.,
bioRxiv - Immunology 2020
Quote:
... Histogram overlays were produced using FCS Express (V.3) software (De Novo Software).