-
No products found
because this supplier's products are not listed.
Srideshikan Sargur Madabushi, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The mouse and humanized anti-human CD33 mAb were conjugated with the metal chelator 1,4,7,10-tetraazacyclododecane-N,N′,N′′,N′′′-tetraacetic acid (NHS-DOTA; Macrocyclics, Dallas, TX) as previously described (12) ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Olivier Messina, et al.,
bioRxiv - Genomics 2022
Quote:
... attached to a 1:10 poly(L-lysine):water coated coverslip and mounted into a FCS2® flow chamber (Bioptechs, USA). ~20-30 embryos were selected and imaged using two regions of interest (ROI 200×200μm2) ...
-
No products found
because this supplier's products are not listed.
Samim Ali Mondal, et al.,
bioRxiv - Physiology 2022
Quote:
... (4) CCl4 + 17α preventive (n=18): chow+17α (14.4 mg/kg; Steraloids, Newport, RI)-fed for eight weeks while simultaneously being CCl4-treated twice weekly for eight weeks ...
-
No products found
because this supplier's products are not listed.
Enrica Saponara, et al.,
bioRxiv - Physiology 2021
Quote:
... L-Type Triglycerol M (Wako Diagnostics, Enzyme Color R1 & R2), 96-well ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Leszek Michalak, et al.,
bioRxiv - Microbiology 2020
Quote:
... using a GEA pilot-scale filtration system Model L (GEA, Denmark). The fraction retained by the membrane was concentrated by nanofiltration using a TriSep XN 45 ...
-
No products found
because this supplier's products are not listed.
Juliet Mwirigi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cells were plated onto Poly-L-Lysine coated E-plates (ACEA Biosciences) in low serum medium (5% FBS ...
-
No products found
because this supplier's products are not listed.
Huabo Wang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... All animals were maintained on 8 mg/L NTBC (Ark Pharm, Libertyville, IL) in their drinking water ...
-
No products found
because this supplier's products are not listed.
Amalie Carnbring Bonde, et al.,
bioRxiv - Biochemistry 2021
Quote:
The effect of the FX/FXa N-glycan variants on thrombin generation was measured in FX-depleted plasma (Affinity Biologicals, Ontario, Canada) supplemented with neutralizing FVIII antibodies ...
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
No products found
because this supplier's products are not listed.
Melissa A. Fischer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 1x L-GlutaMAX) and treated for 48 hours with an MCL1 inhibitor (S63845; Chemietek, Indianapolis, IN), BCL2 inhibitor (venetoclax ...
-
No products found
because this supplier's products are not listed.
Joana T. Lima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5μL of Lipofectamin 2000 and 0.6μg of HaloTag9-LaminB1 plasmid were diluted separated and incubated in OPTIMEM (Alfagene) for 30 min ...
-
No products found
because this supplier's products are not listed.
Shijie Jin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 15 μl of concentrated and filtered ACM (500 μl from 10 mL/sample) or calibration particles included in the reagent kit were placed in the Nanopore (NP150, Izon Science). Samples were measured at 44∼45 mm stretch with a voltage of 0.6∼0.8 V at 1-pressure levels of 10 mbar ...
-
No products found
because this supplier's products are not listed.
Adélaïde A. Mohr, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 20-µL blood sample was collected from the saphenous vein for fasting insulin quantification (ELISA kit #10-1247-01 from Mercodia, Uppsala, Sweden).
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
C2bbe1 cells (CRL-2102) were maintained in DMEM with 110 mg/L Sodium Pyruvate (Thermo 11995065) supplemented with 10% FBS (Atlas Biologicals F-0500-D), penicillin-streptomycin (Thermo 15140122 ...
-
No products found
because this supplier's products are not listed.
Thibaut Vignane, et al.,
bioRxiv - Biochemistry 2023
Quote:
... (anti-Prdx-SO3 [Abcam, #ab16830], 1:4000; anti-oxDJ-1 [Sigma-Aldrich, #MABN1773], 1:2000; anti-GAPDH-SO3 [Abfrontier, #LF-PA0006] ...
-
No products found
because this supplier's products are not listed.
A. C. Rothchild, et al.,
bioRxiv - Immunology 2019
Quote:
... and injecting 1 mL PBS using a 20G-1” IV catheter (McKesson) connected to a 1 mL syringe ...
-
No products found
because this supplier's products are not listed.
Chanchal Thomas Mannully, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1 μM PD0325901 (Biogems, Peprotech), mouse Leukemia inhibitory factor (LIF ...
-
No products found
because this supplier's products are not listed.
Kai-Ting Huang, et al.,
bioRxiv - Physiology 2024
Quote:
... IP3R2 (Antibody Research Corporation; 1:1000), IP3R3 (BD Transduction Laboratory ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Pranay Mandal, et al.,
bioRxiv - Neuroscience 2020
Quote:
Rhodamine-phalloidin (#6876, 1:125, Setareh Biotech, USA) was added along with secondary antibody during immunocytochemistry.
-
No products found
because this supplier's products are not listed.
Chaim Glück, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a glass pipette was inserted into the lumen of the MCA and 1 μL of thrombin (1 UI; HCT-0020, Haematologic Technologies Inc) was injected to induce in situ clot formation (Fig ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Systems Biology 2020
Quote:
Liver samples were defrosted on ice and homogenized in 1 mL of PBS in tubes containing 1 mm zirconium beads (OPS Diagnostics, Lebanon, NJ, USA) on a Mini Bead Beater homogenizer (BioSpec products ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Biochemistry 2020
Quote:
... were incubated with sAGP-1 or nAGP-1 (25, 50 and 100 μg/ml) in triplicate wells in twelve well cell culture plates (Nest Biotechnology Co. Ltd., China) pre-coated with 0.2% gelatin ...
-
No products found
because this supplier's products are not listed.
Stavroula Bitsi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 1 mg/mL collagenase from Clostridium histolyticum (S1745602, Nordmark Biochemicals), dissected ...
-
No products found
because this supplier's products are not listed.
Ioanna Smyrlaki, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and additional respective emission filter described later (Table 1.) (Chroma Technology) and the signal was recorded with an iXon Ultra 888 EMCCD camera (Andor ...
-
No products found
because this supplier's products are not listed.
Tomotaka Okamura, et al.,
bioRxiv - Immunology 2020
Quote:
... flat-bottom plates were coated with an anti-IFN-γ monoclonal antibody (clone MD-1; U-Cytech, Utrecht, Netherlands) and blocked with 2% BSA in PBS ...
-
Peptide to CLIP (85-99)
Cat# CCP2212,
1 mg USD $156.0, 5 mg USD $390.0, 10 mg USD $585.0
Ask
Yingjuan Liu, et al.,
bioRxiv - Genetics 2020
Quote:
... or goat-anti-rabbit H&L FITC (Cohesion Biosciences), with a dilution of 1:200.
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
Recombinant HTLV-1 gp46 protein, fused to His-tag, was expressed in HEK293.
Cat# GB46-01VH,
50ug , USD $298
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
Carbohydrate
Cat# GMS0273S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A 1:1 Luminol and peroxide (Protein Simple) mixture was then added to generate chemiluminescent light ...
-
No products found
because this supplier's products are not listed.
Martin L. Read, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... AP2α1 (1:400; Antibodies.com), AP2μ2 (1:500 ...
-
No products found
because this supplier's products are not listed.
Carole J Kuehl, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-Shigella FITC (1/1000, Virostat), and anti-mouse E-cadherin (1/100 ...
-
No products found
because this supplier's products are not listed.
Miner Deng, et al.,
bioRxiv - Microbiology 2023
Quote:
... and Sporo-Glo (Waterborne, 1:20) for 60 min ...
-
No products found
because this supplier's products are not listed.
Marisa Oliveira, et al.,
bioRxiv - Immunology 2020
Quote:
... P/S and 25 ng/ml recombinant chicken colony stimulating factor 1 (CSF-1) (Kingfisher Biotech, Inc) at 41 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Frank M. Mason, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... telomere (PNA, TelC-A647, 1:500), Acro-P (Cytocell, LPE NOR, undiluted) or rDNA (Empire Genomics, RPCI23-225M6, 1:5) FISH probes were diluted in hybridization solution (10mM Tris-HCl pH7.2 ...
-
No products found
because this supplier's products are not listed.
Sean K. Wang, Yunlu Xue, Constance L. Cepko,
bioRxiv - Neuroscience 2021
Quote:
... or 1:500 of anti-SIRPα (QED Bioscience) in blocking solution overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
John M. Thomas III, et al.,
bioRxiv - Pathology 2019
Quote:
Mounted sections of tissue were incubated in PBTB (sterile PBS + .01% Tween20 + 0.2% BSA) for 1 hour followed by incubation in 1:500 dilution of primary antibody (Arigo Biolaboratories, Taiwan) for either 1 hour at room temperature or overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Patrick M. Nolan, et al.,
bioRxiv - Physiology 2022
Quote:
... according to kit instructions (Assaypro cat no EC3001-1) at a 1/20 dilution ...
-
No products found
because this supplier's products are not listed.
Vesa Havurinne, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The same area where FV/FM was measured (approximately 1 cm2) was cut out of the leaves/algal clusters and placed in a 1 ml Dounce tissue grinder (DWK Life Sciences, Millville, NJ, USA) filled with 0.5 ml of osmotic shock buffer (Table 1 ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-HCV core (clone B2, Anogen MO-I40015B, 1:7,500); mouse anti-JFH-1 NS5A (clone 7B5 ...
-
No products found
because this supplier's products are not listed.
Anika Koetemann, Bernd Wollscheid,
bioRxiv - Cell Biology 2020
Quote:
Filter-grown cells were treated with 1 μM SF1670 (Lucerna Chem) and/or 1 μM LY29400 in 20 ml serum-free DMEM ...
-
No products found
because this supplier's products are not listed.
Till S. Harter, et al.,
bioRxiv - Physiology 2021
Quote:
... and 1% normal goat serum (Lampire Biological Laboratories 7332500; Pipersville, USA) in PBS and incubated for six hours on a rotator ...
-
No products found
because this supplier's products are not listed.
Ella N Hartenian, Britt A Glaunsinger,
bioRxiv - Microbiology 2019
Quote:
... or anti-ORF59 antibody (Advanced Biotechnologies 13-211-100 at 1:200) in 5% BSA overnight at 4 °C ...