-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated human serum albumin b-HSA (70 kg/mol, ACROBiosystems HSA-H82E3, Fisher Scientific), biotinylated heparan sulfate b-HS (synthesized using hydrazone ligation to 12 kg/mol HS and characterized by QCM-D to determine % of biotinylation as described in Thakar et al ...
-
No products found
because this supplier's products are not listed.
Dessislava Malinova, et al.,
bioRxiv - Immunology 2020
Quote:
... for mouse splenic B cells and goat F(ab’)2 anti-human Fc5μ (Jackson Immunoresearch) for Ramos and DG75 cells ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Rosy P. Cárdenas-Sandoval, et al.,
bioRxiv - Bioengineering 2021
Quote:
Soft cantilevers T R400P B (Olympus, Japan) with a nominal spring constant of 0.09 N/m ...
-
No products found
because this supplier's products are not listed.
Solveig G. Schmidt, et al.,
bioRxiv - Biophysics 2023
Quote:
... The uptake reaction was terminated by filtering the samples through a 96 well glass fiber filter (Filtermat B – GF/B, Perkin Elmer) soaked in 1.5% poly(ethyleneimine ...
-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Seong Su Kang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... MAO-B (GeneTex), MAO-A (GE healthcare) ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Swarnabh Bhattacharya, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Rho Activator II (Cytoskeleton, CN03-B), or Verteporfin (Sigma ...
-
No products found
because this supplier's products are not listed.
Lisa C Green, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and stained with Picrosirius Solution B (Polysciences, 24901B) for one hour at room temp ...
-
No products found
because this supplier's products are not listed.
Yunfan Bai, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 μL of IS B (Avanti Polar Lipids Inc.) containing 1.0 nmol monoacylglycerol (MG ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Paul V. Hickner, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and Sobral 1S-B and Jacobina-A (3MαH).
-
No products found
because this supplier's products are not listed.
Chelcie F. Heaney, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and Fmr1 KO (B.6129P2-Fmr1tm1Cgr/J, Jackson Laboratory) mice between the ages of 2-5 months were used ...
-
No products found
because this supplier's products are not listed.
Manuel Albanese, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human primary B cells were prepared from adenoidal mononuclear cells by Ficoll Hypaque (PAN Biotech) gradient centrifugation (as described in Albanese et al. ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Amy Lam, et al.,
bioRxiv - Biophysics 2021
Quote:
... Octadecyl rhodamine B chloride (R18) dye was purchased from Biotium, Inc ...
-
No products found
because this supplier's products are not listed.
Nicole L. Grant, et al.,
bioRxiv - Immunology 2022
Quote:
... and 10% human A/B serum (Gemini Bio-Products, Cat. #100-512). Peptides were added to prepared plates at a final concentration of 1μg/mL-2μg/mL followed by 1x105-2x105 fresh or frozen (rested overnight ...
-
No products found
because this supplier's products are not listed.
Brandon T Paradoski, et al.,
bioRxiv - Immunology 2024
Quote:
... Human B cell stimulation used 10ng/mL Goat F(ab’)2 Anti-human IgM (Southern Biotech #2022-01), 2ug/mL of recombinant human sCD40 (invitrogen PHP0025) ...
-
No products found
because this supplier's products are not listed.
Sandhya Manohar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Aurora B (Bethyl, A300-431) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Josie L Ferreira, et al.,
bioRxiv - Microbiology 2022
Quote:
... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Xiao Du, et al.,
bioRxiv - Genomics 2020
Quote:
... (b) All SVs detected by PacBio CCS Reads and supported by either PacBio CLR or ONT were retained ...
-
No products found
because this supplier's products are not listed.
Arpan De, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Cell adhesion assays were performed using ECM cell adhesion array kit (Cell Biolabs, Inc. ...
-
No products found
because this supplier's products are not listed.
Marco Di Gioia, et al.,
bioRxiv - Immunology 2023
Quote:
... His-tagged recombinant human AKT1 (BPS Bioscience, Cat# 40003), AKT2 (BPS Bioscience ...
-
Schisandrin B is the most abundant dibenzocyclooctadiene lignan present in the traditional...
Cat# S3600, SKU# S3600-10mg,
10mg, $170.00
Ask
Bo-Ruei Chen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... abl pre-B cells were treated with 3 μM imatinib (Selleck Chemicals, S2475) for 2 (for chromatin-bound RPA assay ...
-
No products found
because this supplier's products are not listed.
Kerim Anlaş, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... low adhesion 96-well-plate (96WP, Greiner, 650970) which was thereafter returned to the incubator and maintained at 37°C and 5% CO2.
-
No products found
because this supplier's products are not listed.
Nuri K. Hegelmeyer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Strains containing selectable markers were cultured on medium with 50 µg/mL hygromycin (Hygromycin B Solution, Mirus) or 25 µg/mL kanamycin (GoldBio ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mariam Taha, et al.,
bioRxiv - Microbiology 2023
Quote:
... b) 500 µL of 10% (v/v) human synovial fluid (BioIVT, Westbury, NY, USA) prepared in sterile Ringer’s solution (37) ...
-
No products found
because this supplier's products are not listed.
Marta Zaninello, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 250 μg/ml Amphotericin B (Promocell), 1 μM cytosine arabinoside (Sigma) ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Lauren E. Stopfer, et al.,
bioRxiv - Bioengineering 2021
Quote:
... using 100 μg of pan-specific anti-human MHC Class I (HLA-A, HLA-B, HLA-C) antibody (clone W6/32, Bio X Cell) per 1e6 cells ...
-
No products found
because this supplier's products are not listed.
Jingxia Lu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the SpaKC sample was loaded to column B (Nanotemper MO-L011) and eluted with 450 μL of assay buffer (50mM Na2CO3/NaHCO3 ...
-
No products found
because this supplier's products are not listed.
Liam P. Hallada, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or 1,000,000 JAM-C-SNAP replaced CGNs into single wells of #1.5 coverslip bottom µ-slides (Ibidi). The conditions were live-imaged for FRAP experiments in an environmentally controlled on a Marianis Spinning Disk Confocal Microscope (Intelligent Imaging Innovation) ...
-
No products found
because this supplier's products are not listed.
Ana F. Ferreira, et al.,
bioRxiv - Neuroscience 2023
Quote:
Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Chong Li, et al.,
bioRxiv - Genomics 2023
Quote:
... Hi-C libraries were generated with 1.5 M human cells as input using Proximo Hi-C kits v4.0 (Phase Genomics, Seattle, WA) according to the manufacturer’s protocol with the following change ...
-
No products found
because this supplier's products are not listed.
Jessica Knox, et al.,
bioRxiv - Genetics 2023
Quote:
... Cyprocide-B was purchased from ChemBridge Corporation and Vitas-M ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Aurora Alvarez-Buylla, et al.,
bioRxiv - Physiology 2023
Quote:
... we used the Zymo RiboFree Total RNA Library Prep kit (R3003-B, Zymo Research, Irvine, CA) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...