-
No products found
because this supplier's products are not listed.
Elsa Mazari-Arrighi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Janine Hochmair, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 14-3-3 (#ab51129, Abcam), and α-tubulin (#T6074 ...
-
No products found
because this supplier's products are not listed.
Devin Dersh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-14-3-3 (Santa Cruz).
-
No products found
because this supplier's products are not listed.
Dominique Massey-Harroche, et al.,
bioRxiv - Cell Biology 2023
Quote:
... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
No products found
because this supplier's products are not listed.
Mina N. F. Morcos, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Interleukin-3 (rmIL-3 20ng/ml, PeproTech), Erythropoietin (rhEPO ...
-
No products found
because this supplier's products are not listed.
Hridesh Banerjee, et al.,
bioRxiv - Immunology 2020
Quote:
... Tim-3 clone RMT 3-23 (BioLegend) and clone FAB1529 (R&D) ...
-
No products found
because this supplier's products are not listed.
Peter H. Culviner, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
No products found
because this supplier's products are not listed.
Caitlyn B. Smith, et al.,
bioRxiv - Microbiology 2024
Quote:
... zonula occludens-3 (ZO-3) (Cell Signaling Technologies), anti-mouse IgG (Alexa Fluor® 488 ...
-
No products found
because this supplier's products are not listed.
BL Spencer, et al.,
bioRxiv - Microbiology 2021
Quote:
... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
No products found
because this supplier's products are not listed.
Morten S. Hansen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Matthew D. Martens, et al.,
bioRxiv - Cell Biology 2021
Quote:
... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
No products found
because this supplier's products are not listed.
Maxime Ardré, Djinthana Dufour, Paul B Rainey,
bioRxiv - Microbiology 2019
Quote:
... 3 (BD ref211693), 10 g glycerol ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
No products found
because this supplier's products are not listed.
Bas Brouwers, et al.,
bioRxiv - Physiology 2020
Quote:
... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Tomonari Matsuda, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 (Illumina).
-
No products found
because this supplier's products are not listed.
Ana Lima, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and 3 μM GSK-3 inhibitor CHIR9902 (Cayman Chemicals) for 2 days at 37°C in 5% CO2 incubator ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
No products found
because this supplier's products are not listed.
E. C. Brombacher, et al.,
bioRxiv - Immunology 2023
Quote:
... 3% SDS (151-21-3, VWR Life Science) and 100 mM Tris–HCl [pH 6.8](1.00317 ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Brian Ritchey, et al.,
bioRxiv - Genetics 2021
Quote:
... 3 ng/ml mouse IL-3 (R&D Systems) and 20% L-cell conditioned medium ...
-
No products found
because this supplier's products are not listed.
Romina Marone, et al.,
bioRxiv - Bioengineering 2023
Quote:
... containing 300 cells and with 10ng/ml IL-3 (+IL-3 treatment) or without IL-3 (-IL-3 treatment) were plated in a well of a SmartDish (StemCell Technologies, Seattle, WA, USA) in duplicates ...
-
No products found
because this supplier's products are not listed.
Sethu M. Madhavan, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Patrick A. Carroll, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-TXNIP (WB and IF, K0204-3, K0205-3, MBL International), anti-PGK1/2 (WB and IF ...
-
No products found
because this supplier's products are not listed.
Eric E. Irons, et al.,
bioRxiv - Immunology 2019
Quote:
... IL-3 (5ng/ml; BioVision), TPO (25ng/ml ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Casey L. Mahoney-Crane, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were developed using ImmPACT-3 3’-diaminobenzidine (DAB; Vector Labs), sequentially dehydrated as previously described (Stoyka et al. ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Edinson Lucumi Moreno, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 M CHIR (Axon Medchem) and 150 M Ascorbic Acid (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Sangeeta Goswami, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′-3-diaminobenzidine (DAB) substrate (Leica Microsystems) was used as a chromogen followed by hematoxylin counterstain ...
-
No products found
because this supplier's products are not listed.
Robert M. Cooper, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 3 μM GSK-3 inhibitor (XVI, Calbiochem; 361559) for the first 3 days.
-
Cat# HY-130704-50 mg,
50 mg, USD $1050.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
because this supplier's products are not listed.
Theofilus A. Tockary, et al.,
bioRxiv - Bioengineering 2022
Quote:
... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3-micron beads (Polysciences Inc) were resuspended in 0.1 M Borate and incubated with human IgG at 4°C overnight while rotating ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Biggs, Elizabeth A.D. Hammock,
bioRxiv - Neuroscience 2022
Quote:
... glass pipettes (3-8 MΩ, 1B150F-3, World Precision Instruments) were pulled using a horizontal puller (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Alex Rosenberg, L. David Sibley,
bioRxiv - Microbiology 2020
Quote:
... on Cytation 3 (BioTek) multimode plate imager according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Feini Qu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and cyanine 3 (PerkinElmer), respectively ...
-
No products found
because this supplier's products are not listed.
Lina Hacker, et al.,
bioRxiv - Bioengineering 2020
Quote:
DNA was isolated from liver samples of female C57BL/6J mice (3-4 months; n=3) and Wistar rats (6-9 months; n=3) (Charles River) using the Qiagen DNeasy Blood/Tissue kit following the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Izabela Todorovski, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
No products found
because this supplier's products are not listed.
E.H. Bowler-Barnett, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... pH 3-10 (GE Healthcare) and peptides focused for 20 kVh ...
-
No products found
because this supplier's products are not listed.
Alison L. Wong, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3% paraformalydehyde (15754-S, EMS) and 0.1 M Sorensen’s phosphate buffer pH 7.2 solution ...
-
No products found
because this supplier's products are not listed.
Kyle Wellmerling, et al.,
bioRxiv - Developmental Biology 2019
Quote:
3 60mm plates (Corning, CLS430166) of Day 9 hiPSC-NPCs were mixed and pumped through anti-SSEA-5 and isotype control functionalized GEDI chips at 1ml/hr for 30 min ...