-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Sections of 5 μm from the paraffin embedded mouse tumors or slides of the lung adenocarcinoma tissue array (US Biomax, LC1504) were heated to 55°C for 20 min prior to deparaffinization in xylene (Fisher scientific ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
J. Aaron Crapster, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... anti-ZP3R/mouse sp56 (7C5) (QED Bioscience, 55101, lot 051614-120816, mouse mAb); anti-IZUMO1 (125 ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-fluorotryptamine hydrochloride (AstaTech, Catalog #52030), 6-fluorotryptamine (AstaTech ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
No products found
because this supplier's products are not listed.
Catherine D. Stark, et al.,
bioRxiv - Biochemistry 2021
Quote:
The KSI substrate 5(10)-estrene-3,17-dione (5(10)EST) was purchased from Steraloids (Newport, RI). Reactions of purified KSIs with 5(10)EST were monitored continuously at 248 nm using a Perkin Elmer Lambda 25 UV/Vis spectrometer with an attached VWR digital temperature controlled circulating water bath (Pinney et al. ...
-
No products found
because this supplier's products are not listed.
Cameron Vergato, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-mouse IFNAR-1 antibody or mouse IgG (cat. #MS-GF-ED, Molecular Innovations, Novi, MI) diluted in sterile PBS and injected i.p ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Tobie D. Lee, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... R-5 cells were incubated in a similar fashion except 5 μM pheophorbide A (PhA, Frontier Scientific, Logan, UT) was used as the substrate and 10 μM fumitremorgin C (FTC ...
-
No products found
because this supplier's products are not listed.
Kiyohiko Andoh, Asami Nishimori, Yuichi Matsuura,
bioRxiv - Microbiology 2023
Quote:
... mouse anti-BLV p24 MAb (VMRD: BLV3), mouse anti-His tag MAb (MBL ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Nicholas F. Page, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Serum was diluted with PBS/0.2%BSA to fall into the linear range of a primate-specific IL-6 ELISA assay (Cell Sciences, Canton, MA), and the assay was performed according to the manufacturer’s instructions (see ref 25) ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Joanna J. Moss, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and anti-mouse (G32-62G, 1:10,000, SignalChem) horseradish peroxidase-conjugated antibodies at room temperature for 1 hr before exposure on photographic film (28906844 ...
-
No products found
because this supplier's products are not listed.
Yongchan Lee, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and L-[3H]alanine (5 Ci/mol; Moravek Biochemicals)) were measured for 3 min in Na+-free HBSS pH 7.4 ...
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse AECs were stained for Muc5b by mouse monoclonal antibody 3AE (27) and rabbit antibody Scgb1a1 (Seven Hills BioReagents WRAB-3950).
-
No products found
because this supplier's products are not listed.
Valentin Mitterer, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Growth phenotypes of the mutant alleles were analysed on plates containing 1 g/l 5-fluoroorotic acid (5-FOA) (Apollo Scientific, Cat# PC4054) to select for cells that have lost the wild-type SPB4-containing URA3 plasmid ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti ZIKV Envelope (#BF-1176-56, BioFront Technologies) and chicken antibody to SENV (#ab33988 ...
-
No products found
because this supplier's products are not listed.
M.M. Joglekar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... VCAN (1:200, Mouse Anti-Versican Antibody 2B1, Seikagaku), and ELN (1:400 ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Elke M. Muntjewerff, et al.,
bioRxiv - Physiology 2021
Quote:
... Mouse EIA kits from CUSABIO (CUSABIO Technology LLC, Houston, TX) were used to determine CgA (CSB-EL005344MO) ...
-
No products found
because this supplier's products are not listed.
Qi Ma, Hongyu Ruan, Huihui Dai, Wei-Dong Yao,
bioRxiv - Neuroscience 2023
Quote:
... DUAL hybrid cDNA Library -mouse cortical neurons (Bulldog Bio, P12401) and reverse primer ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Hirashima, Michiyuki Matsuda,
bioRxiv - Developmental Biology 2022
Quote:
... we used Hoechst33342 (5 µg ml-1, Dojindo Molecular Technologies, #H342) or DAPI (Dojindo Molecular Technologies ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Amrita Srivastava, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse ankles were fixed for 24 hours in buffered zinc formalin (Anatech Ltd), decalcified for 9 days in Shandon TBD-2 ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... and Mouse Polink-2 HRP (GBI Labs; Cat. No. D37-110 for Mx1). Slides were developed using Impact™ DAB (3,3′-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2023
Quote:
Modified Hoagland’s solution imaging gels solidified with 5% Gelzan™ (Caisson Labs, UT, USA) were prepared for the root imaging experiments ...
-
No products found
because this supplier's products are not listed.
Changuk Chung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and cellular/nuclear disruption was performed for 5 min on a DisruptorGenie (Scientific Industries), supernatant was transferred to a DNA Mini Column from an AllPrep DNA/RNA Mini Kit (Qiagen ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
,
bioRxiv - Microbiology 2019
Quote:
... brain and lungs were collected and placed in labeled 5 ml tubes (CELLTREAT, Pepperell, MA) containing 2 ml of HBSS with no dye on ice ...
-
No products found
because this supplier's products are not listed.
Scott C. Bolton, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the culture was supplemented with 10 mL (5%) Boost Production Additive (Expression Systems LLC, Davis, CA) where indicated ...
-
No products found
because this supplier's products are not listed.
Sithurandi Ubeysinghe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 25 µL aliquot was pipetted from the cell suspension into a 4×5 mm glass cylinder (7030304; Bioptechs) fixed on a glass bottom dish with high-temperature silicon grease ...