-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using a diamond knife (Histo HI 4317, Diatome). Afterwards sections were stained according to Gallyas52 and with Methylene blue/ Azur II for 1 min ...
-
No products found
because this supplier's products are not listed.
Thomas D. Avery, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
NRF2/ARE luciferase reporter HEK293 cells (SL-0042-NP, Signosis, Santa Clara, USA) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Chafen Lu, et al.,
bioRxiv - Microbiology 2019
Quote:
... Secondary antibodies were rabbit polyclonal anti-His (Delta Biolabs), Horseradish peroxidase (HRP)-anti-rabbit and HRP-anti-mouse IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura Sánchez-Caballero, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HEK293 cells expressing inducible NDUFAF3-GFP were cultured in a Wilco dish (Intracel, Royston, UK), washed with phosphate-buffered saline (PBS) ...
-
No products found
because this supplier's products are not listed.
Aman Y. Husbands, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were washed three times with PBS-T and incubated with 1:2000 anti-His-tag antibody (Abiocode M0335-1) for 1h with gentle shaking at RT ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-human TFAM (1:1000, PhosphoSolutions, Catalog# 1999-hTFAM), Anti-mouse TFAM (1:1000 ...
-
No products found
because this supplier's products are not listed.
Takahiro Sanada, et al.,
bioRxiv - Microbiology 2022
Quote:
... AB human serum (Pel-Freez Biologicals, Rogers, AR, USA) was used as control serum.
-
No products found
because this supplier's products are not listed.
Shahrnaz Kemal, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All vectors contain an N-terminal 6x-His-tag, C terminal Strep-Tag II tag, with or without a N or C terminal fluorophore (EGFP, mNeonGreen (Allele Biotech), or mRuby2).
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... A previously reported (16,54) human GPR37L1 was purchased from Multispan; however ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Masaya Matsubayashi, et al.,
bioRxiv - Biochemistry 2019
Quote:
The human hepatocellular carcinoma cell HepG2 was purchased from Cellular Engineering Technologies ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Kyle E. Landgraf, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Human PBMC stimulation and immune-phenotyping studies were performed by iQ Biosciences. Briefly normal PBMCs from three donors were seeded in 96-well plates at 1×105 cells/well and exposed to a 10-fold dilution series of either U2S3-hFc-mutIL2 or U2S3-hFc-wtIL2 (wild-type IL2 ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Erdem D. Tabdanov, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human CD4+ T cells were plated on a glass-bottom dish (Willco Wells) pre-coated with either ICAM-1 (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Ghulam Destgeer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... particles were incubated with varying concentrations of human recombinant NT-proBNP (HyTest, Finland) for 1 hr with subsequent washing ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Vincent Mouilleau, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SA001 embryonic stem cell (ESC) line (male, RRID: CVCL_B347) was obtained from Cellectis and used accordingly to the French current legislation (Agency of Biomedicine ...
-
No products found
because this supplier's products are not listed.
Ashley F. Melnick, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human and murine T-ALL cells were treated at increasing doses of berzosertib (Chemietek) for 9-10 days ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled A*0201 dextramer negative control (Immudex, 1:5). Antibodies for western blot ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For quantification of Panx1 plasma concentration in AAA patients a human Panx1 ELISA (#39097, Signalway Antibody) was performed ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Tamara A. Potapova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Fluorescein-labeled probe for human rDNA (BAC clone RP11-450E20) was obtained from Empire Genomics (Buffalo, NY). Specimens and the probe were denatured together for 7 min at 85°C and hybridized under HybriSlip hybridization cover (GRACE Biolabs ...
-
No products found
because this supplier's products are not listed.
Jack George, Howard T. Jacobs,
bioRxiv - Molecular Biology 2019
Quote:
... Membranes were blocked in 5% nonfat milk in PBS-0.05% Tween (Medicago) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Elena A. Andreeva, et al.,
bioRxiv - Biophysics 2022
Quote:
... the protein solution (∼ 5 ml) was circulated with a peristaltic pump (Gilson Minipuls 3) through a 2 mm X-ray quartz capillary in a closed loop ...
-
No products found
because this supplier's products are not listed.
Yunwei Lu, et al.,
bioRxiv - Systems Biology 2024
Quote:
We performed eY1H assays using a human TF yeast array (15) as previously described and as follows using a high-density array ROTOR robot (Singer Instruments). The three-plate human TF yeast array and promoter yeast strains were mated pairwise on permissive media agar plates and incubated at 30°C for 1 day ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Genomics 2021
Quote:
... were first treated with oxygen plasma for 5 mins (Anatech Barrel Plasma System, 100W, 40% O2) followed by methacryloxypropyltrimethoxysilane (Bind-Silane ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Ram Sagar, et al.,
bioRxiv - Genetics 2023
Quote:
To acquire a high yield of functional neurons we transduced the generated human iPSCs with Ngn2 and rTTA expressing lentivirus (lentivirus was purchased by Cellomics Technology, Maryland USA). We followed an established protocol for generation of induced neuronal cells in 21 days 17 ...
-
No products found
because this supplier's products are not listed.
Thomas W Jackson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 5 μl of Proteinase K (20 mg/ml; Viagen Biotech, Los Angeles, CA; Cat: 501-PK) were added to the biopsy sample ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2023
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-5) in RPMI 1640 1 % FBS ...