-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Parafilm (Bemis, IL, USA)
-
No products found
because this supplier's products are not listed.
Laiyin Nie, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The liposomes were disrupted by the addition of 22 mM sodium cholate (Anatrace). Purified ZMPSTE24 was added into the mixture at lipid protein ratio (LPR ...
-
No products found
because this supplier's products are not listed.
Jochen Meyer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A single-pane #1 cover glass (22×11 mm, Thomas Scientific, Swedesboro, NJ) was cut and adjusted to the individual dimensions (approx ...
-
No products found
because this supplier's products are not listed.
Ozan S. Kumru, et al.,
bioRxiv - Immunology 2023
Quote:
... which was purchased from Pfanstiehl (Waukegan, IL).
-
No products found
because this supplier's products are not listed.
Bamaprasad Dutta, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... which was conducted using a C18 column (250 × 22 mm; 5 μm particle size; Phenomenex, USA) at a flow rate of 5 mL/min with a linear gradient of 1%/min of 10%– 80% buffer B [0.1% trifluoroacetic acid (TFA ...
-
No products found
because this supplier's products are not listed.
Venkatramana D. Krishna, et al.,
bioRxiv - Microbiology 2023
Quote:
... Brains were embedded in Tissue-Tek OCT (Andwin Scientific, IL) on dry ice ...
-
No products found
because this supplier's products are not listed.
I.M. Brandt, et al.,
bioRxiv - Neuroscience 2024
Quote:
... first dorsal interosseous muscle (FDI) and extensor digitorum communis (EDC) using Ag/AgCl surface electrodes (dimensions 22*30 mm, Ambu A/S BlueSensor N-10-A/25 ECG electrodes ...
-
No products found
because this supplier's products are not listed.
E.A. Matthews, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in a temperature (22±2°C) and humidity (55±10%) controlled environment with food/water ad libitum and nesting material (nestlets, Ancare, USA). Animals were allowed at least 1 week of acclimatization to the animal facility before surgery and singly housed after surgery ...
-
No products found
because this supplier's products are not listed.
Siu-Shing Wong, et al.,
bioRxiv - Cell Biology 2024
Quote:
... embryos were injected with the nanobody-coated beads and mRNA mix and incubated for a further 1 hour at 22°C prior to imaging on the Andor DragonFly 505 (Oxford Instruments) spinning disk system described below.
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... human angiotensin II (HelloBio®); N-Methyl-D-Aspartate (NMDA ...
-
No products found
because this supplier's products are not listed.
Xiong Liu, et al.,
bioRxiv - Physiology 2022
Quote:
... DTT was purchased from Thermo Fisher Scientific (Ottawa, ON, Canada) and disuccinimidyl tartrate (DST) from CovaChem (Loves Park, IL).
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... media containing PBS or recombinant IL-1β (10 ng/ml) (Abbkine, PRP100051, USA) was added to the basal chambers for 3 days.
-
No products found
because this supplier's products are not listed.
Helen R. McPherson, et al.,
bioRxiv - Physiology 2021
Quote:
... Human FXIII-A2B2 from Zedira (Darmstadt, Germany) was further purified from contaminating albumin and glucose by Hiload 16/60 superdex 200 (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
M.A. Andres, et al.,
bioRxiv - Neuroscience 2022
Quote:
Human neural progenitor cells (hNPCs) (Neuromics, MN) were plated on Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Maurizio Chioccioli, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... using human Col1a1 and Acta2 primers from ABI for the specified gene and species.
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
M Azharuddin, et al.,
bioRxiv - Immunology 2021
Quote:
... or anti-human IgA-HRP (Nordic BioSite, Täby, Sweden) was added to separate wells with diluted serum samples and incubated 90 min ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
because this supplier's products are not listed.
Norie Sugitani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... supplemented with 1 µM human gp100 (25-33) (Eurogentec) and 50 U/mL IL-2 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
This kit is a sandwich ELISA assay for the quantitative measurement of ACAT1 in human serum,...
Cat# KITE1066,
Inquiry
Ask
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... A375-Luc/iRFP (human melanoma, Creative Biogene CSC-RR0254), MCF7 (human breast cancer ...
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... and human embryonic kidney 293T cells were purchased from Genhunter Corp ...
-
No products found
because this supplier's products are not listed.
Wei Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the human multimeric vitronectin solution (Molecular Innovations Inc, HVN-U) was adjusted to a concentration of 1 mg/mL and then its buffer was exchanged to 0.1 M sodium bicarbonate using a Zeba spin desalting column (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Soumya Mukherjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Commercial pooled human plasma was purchased from Affinity Biologicals (Ancaster, ON). Purified human neutrophils ...
-
No products found
because this supplier's products are not listed.
Bernhard C. Lechtenberg, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the HEK 293AD human embryonic kidney cell line from Cell Biolabs, Inc (AD-100) ...
-
No products found
because this supplier's products are not listed.
Yunxia Tang, et al.,
bioRxiv - Immunology 2019
Quote:
Human IFN-γ ELISPOT assays were performed by ELISPOT kit (Mab Tech). The plates were washed three times with PBS ...
-
No products found
because this supplier's products are not listed.
Barbara D. Fontana, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... Cortisol levels were assessed using a human salivary cortisol ELISA kit (Salimetrics) as previously described (Cachat et al. ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A goat anti-human AAT polyclonal antibody 80A was purchase from ICL Inc ...
-
No products found
because this supplier's products are not listed.
Jean-Louis A. Parmasad, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 500 µL 20 mg/mL human insulin (Wisent Bioproducts, 511-016-CM), 2.5 mL 1M HEPES (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Divyesh Joshi, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Deidentified human specimens were deparaffinized in Histo-Clear (National Diagnostics, HS-200). Sections were progressively rehydrated before antigen retrieval for 30 min at 95°C in 1X Antigen Retrieval Buffer (Dako ...
-
No products found
because this supplier's products are not listed.
Joseph de Rutte, et al.,
bioRxiv - Bioengineering 2021
Quote:
... antibody atezolizumab and the anti-interleukin 8 receptor beta (IL-8Rb) antibody 10H2 were cloned into the gwiz mammalian expression vector (Genlantis) and used for transient transfection of HEK 293T cells loaded into nanovials ...
-
No products found
because this supplier's products are not listed.
Caroline Atyeo, et al.,
bioRxiv - Immunology 2021
Quote:
... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
William T. Molin, et al.,
bioRxiv - Genomics 2020
Quote:
... At the 2 leaf stage the seedlings were sprayed with glyphosate at 0.84 kg·ai·ha−1 using an air-pressurized indoor spray chamber (DeVries Manufacturing Co., Hollandale, MN) equipped with a nozzle mounted with 8002E flat-fan tip (Spraying Systems Co., Wheaton, IL) delivering 190 L·ha−1 at 220 kPa. ...
-
No products found
because this supplier's products are not listed.
Xuedan Sun, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cells were incubated in serum-free DMEM for 24 h and IL-6/8 levels determined in supernatants using the femtoELISA™ HRP Kit (G-Biosciences).
-
No products found
because this supplier's products are not listed.
Linyi Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Human trapezial cartilage was ground to a powder using Cryo-Cup Grinder (Biospec, Bartlesville) and then RNA was extracted using Qiagen RNeasy Micro Kit.
-
No products found
because this supplier's products are not listed.
Ksenia Magidey-Klein, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... B16-F1 cells were transfected with 1 μg DNA of pCMV3 vector encoding IL-6 or the empty control pCMV3 vector (EV) using PolyJet (SignaGen Laboratories, MD, USA) following the manufacturer’s instructions ...
-
ST2 Human ELISA / assay Kit
Cat# K055-H1,
1.0 ea, USD $505.0
Ask
Andres R. Henriquez, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Plasma cortisol levels were analyzed using human cortisol kit from Arbor Assays (Ann Arbor, MI).
-
No products found
because this supplier's products are not listed.
Pehuén Pereyra Gerber, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated for 30 min with a PE-labeled anti–human IgG-Fc antibody (Leinco/Biotrend), washed again ...
-
No products found
because this supplier's products are not listed.
Mean-Hwan Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 350 µm thick human cortical slices were prepared using a Compressome VF-300 (Precisionary Instruments) or VT1200S (Leica Biosystems) ...
-
TIR1 antagonist
Sold for research purposes only.
Cat# 3477.0, SKU# 3477-50 mg,
50mg, US $297.00 / EA, EURO, €270 / EA
Ask
Daniel J. Steinberg, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2.5µg/ml human recombinant Insulin (Biological Industries; 41-975-100) and 3µM CHIR-99021 (Axon Medchem ; 1386) sterilized through 0.22μm filter ...
-
No products found
because this supplier's products are not listed.
Hohyun Cho, et al.,
bioRxiv - Neuroscience 2021
Quote:
The implanted electrode grids were approved for human use (Ad-Tech Medical Corp., Racine, WI; and PMT Corp., Chanhassen, MN). The platinum-iridium electrodes were 4 mm in diameter (2.3 mm exposed) ...
-
No products found
Alexandra Grubman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were transfected for 48 h with dox-inducible GFP-tagged Gateway-generated Piggybac expression constructs with inserted cDNA encoding human HIF1A and/or ELF3 open reading frames using Glial Mag transfection kit (Oz Biosciences, #GL00500) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Jin Wang, et al.,
bioRxiv - Systems Biology 2019
Quote:
... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
No products found
because this supplier's products are not listed.
Thea Brennan-Krohn, et al.,
bioRxiv - Microbiology 2021
Quote:
... Caspofungin (CAS) was obtained from Carbosynth (Oakbrook Terrace, IL). Amphotericin B (AMB ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Aaron M. Rosado, et al.,
bioRxiv - Biophysics 2022
Quote:
... freshly isolated human RBCs were biotinylated with biotin-PEG3500-NHS (Jenkem Technology) and then incubated with nystatin in N2 buffer (265.2 mM KCl ...