-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Yunqing Yu, et al.,
bioRxiv - Plant Biology 2024
Quote:
Parafilm (Bemis, IL, USA)
-
No products found
because this supplier's products are not listed.
Thomas D. Avery, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
NRF2/ARE luciferase reporter HEK293 cells (SL-0042-NP, Signosis, Santa Clara, USA) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jonathan Burnie, et al.,
bioRxiv - Microbiology 2021
Quote:
... Viruses were produced in HEK293 using Polyjet In Vitro Transfection Reagent (FroggaBio, Cat#SL100688). HEK293 cells were seeded at a density of 106 cells/mL in 6-well plates in complete media and were transfected with 3 µg of pDNA after cells had reached 70% confluence ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura Sánchez-Caballero, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HEK293 cells expressing inducible NDUFAF3-GFP were cultured in a Wilco dish (Intracel, Royston, UK), washed with phosphate-buffered saline (PBS) ...
-
No products found
because this supplier's products are not listed.
Hao-Ching Jiang, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... HEK293 cells were plated on 12 mm round German glass coverslips (Bellco Biotechnology, #1943-10012A) coated with poly-d-lysine hydrobromide (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Qiankun Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... Culture supernatant was collected at 22 days for HIV-1 p24 ELISA (XpressBio #XB-1000). The frequency of p24 positive wells was used to calculate the estimate infection frequencies using a limiting dilution calculator (https://silicianolab.johnshopkins.edu/) ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The CuAAC reaction was prepared by combining 22 mg m-PEG-azide (10 kDa, BroadPharm), 44 µL DMSO ...
-
No products found
because this supplier's products are not listed.
Jin Wang, et al.,
bioRxiv - Systems Biology 2019
Quote:
... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
No products found
because this supplier's products are not listed.
Thea Brennan-Krohn, et al.,
bioRxiv - Microbiology 2021
Quote:
... Caspofungin (CAS) was obtained from Carbosynth (Oakbrook Terrace, IL). Amphotericin B (AMB ...
-
No products found
because this supplier's products are not listed.
Maria Steene Eriksen, et al.,
bioRxiv - Biochemistry 2019
Quote:
Fluorescently tagged Arc and StrepII tagged Arc were coexpressed in HEK293 cells and purified using Strep-Tactin Sepharose (IBA Lifesciences). Formation of complexes between the indicated Arc constructs was analyzed by immunoblotting following SDS electrophoresis ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Afrida Rahman-Enyart, et al.,
bioRxiv - Systems Biology 2021
Quote:
... We allowed particulates to settle for 30 s before drawing supernatant into a syringe attached to a 22-gauge gavage needle (Fine Science Tools, Foster City, CA). We pooled together 500 μL of the supernatants from each of the three 1 mL suspensions and deposited 200 μL of this pooled supernatant into the stomach of each recipient mouse by gavage ...
-
No products found
because this supplier's products are not listed.
Rebecca M. Beiter, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human Amyloid Beta1-42 (Echelon Biosciences, 641-15) was dissolved in HFIP (Sigma ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-human TFAM (1:1000, PhosphoSolutions, Catalog# 1999-hTFAM), Anti-mouse TFAM (1:1000 ...
-
No products found
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... A previously reported (16,54) human GPR37L1 was purchased from Multispan; however ...
-
No products found
because this supplier's products are not listed.
Masaya Matsubayashi, et al.,
bioRxiv - Biochemistry 2019
Quote:
The human hepatocellular carcinoma cell HepG2 was purchased from Cellular Engineering Technologies ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Kyle E. Landgraf, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Human PBMC stimulation and immune-phenotyping studies were performed by iQ Biosciences. Briefly normal PBMCs from three donors were seeded in 96-well plates at 1×105 cells/well and exposed to a 10-fold dilution series of either U2S3-hFc-mutIL2 or U2S3-hFc-wtIL2 (wild-type IL2 ...
-
No products found
because this supplier's products are not listed.
Noriki Fujimoto, et al.,
bioRxiv - Immunology 2020
Quote:
10 µg of Dil-labeled human acetylated LDL (Kalen Biomedical, Germantown, MD) or 10 µg of Dil-labeled human oxidized LDL (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Aaron M. Rosado, et al.,
bioRxiv - Biophysics 2022
Quote:
... freshly isolated human RBCs were biotinylated with biotin-PEG3500-NHS (Jenkem Technology) and then incubated with nystatin in N2 buffer (265.2 mM KCl ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... Human commensal type strains were grown on either Brain Heart Infusion (Teknova) agar plates supplemented with 5 μg/mL hemin and 0.5 μg/mL menadione (BHIS ...
-
No products found
because this supplier's products are not listed.
Ghulam Destgeer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... particles were incubated with varying concentrations of human recombinant NT-proBNP (HyTest, Finland) for 1 hr with subsequent washing ...
-
No products found
because this supplier's products are not listed.
William Woolley, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at 833 nm/s, using a Psylotech MicroTest System (Psylotech Incorporated, Evanston, IL, USA) placed inside a low-vacuum SEM (JEOL JSM-5910LV). The pressure was set to 50 Pa to maximize the image quality while maintaining hydration in the bone ...
-
No products found
because this supplier's products are not listed.
Linyi Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Human trapezial cartilage was ground to a powder using Cryo-Cup Grinder (Biospec, Bartlesville) and then RNA was extracted using Qiagen RNeasy Micro Kit.
-
No products found
because this supplier's products are not listed.
Tomoyuki Ohno, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 201B7 human iPS (RIKEN BRC, HPS0063) cells were maintained in StemFit AK02N medium (ReproCELL) in dishes coated with iMatrix-511 (Nippi) ...
-
No products found
because this supplier's products are not listed.
Vincent Mouilleau, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SA001 embryonic stem cell (ESC) line (male, RRID: CVCL_B347) was obtained from Cellectis and used accordingly to the French current legislation (Agency of Biomedicine ...
-
No products found
because this supplier's products are not listed.
Matthew J. Shannon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The assay was validated using a standard curve calibrated against human methylation controls (EpigenDx, USA Cat ...
-
No products found
because this supplier's products are not listed.
Pablo S. Gaete, et al.,
bioRxiv - Biophysics 2024
Quote:
cDNAs for human Cx26 and Cx30 were synthesized and subcloned by Epoch Life Science into pGEM-HA (Promega) ...
-
No products found
because this supplier's products are not listed.
Aereas Aung, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were stained with human VRC01 mAb directly labeled with AF488 NHS ester (21820, Lumiprobe). For non-permeabilized sections ...
-
No products found
because this supplier's products are not listed.
Nandan Haloi, et al.,
bioRxiv - Biophysics 2020
Quote:
... followed by addition of HKII (human recombinant HKII, 60 kU/ml; Genway Biotech, Slan Diego, CA) into the cis chamber ...
-
No products found
because this supplier's products are not listed.
Stephen A. Schumacher, et al.,
bioRxiv - Physiology 2021
Quote:
Serum PTH concentrations were measured with a human-specific immunoradiometric assay (Scantibodies Laboratory, Santee, CA, USA) with a working range of 6.5-2328 pg/mL ...
-
No products found
because this supplier's products are not listed.
Shayan G. Borhani, et al.,
bioRxiv - Bioengineering 2022
Quote:
The homodimeric properties of GRFT were analyzed using an UltiMate™ 3000 HPLC instrument (Thermo Fischer Scientific, Rockford, IL) with a 125 Å 4.6 x 300 mm TSKgel SuperSW2000 column (Tosoh Biosciences, King of Prussia, PA) equilibrated with 1X PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Marco Losa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were dispensed at various volumes into human ASC-coated 1,536-well plates using contactless dispensing with an ECHO 555 Acoustic Dispenser (Labcyte). Thereby ...
-
No products found
because this supplier's products are not listed.
Hohyun Cho, et al.,
bioRxiv - Neuroscience 2021
Quote:
The implanted electrode grids were approved for human use (Ad-Tech Medical Corp., Racine, WI; and PMT Corp., Chanhassen, MN). The platinum-iridium electrodes were 4 mm in diameter (2.3 mm exposed) ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Chong Li, et al.,
bioRxiv - Genomics 2023
Quote:
... Hi-C libraries were generated with 1.5 M human cells as input using Proximo Hi-C kits v4.0 (Phase Genomics, Seattle, WA) according to the manufacturer’s protocol with the following change ...
-
No products found
because this supplier's products are not listed.
Ram Sagar, et al.,
bioRxiv - Genetics 2023
Quote:
To acquire a high yield of functional neurons we transduced the generated human iPSCs with Ngn2 and rTTA expressing lentivirus (lentivirus was purchased by Cellomics Technology, Maryland USA). We followed an established protocol for generation of induced neuronal cells in 21 days 17 ...
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
James F. Pelletier, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... using reactive ion etching to define 3.1 µm deep chambers arrayed along a 100 µm wide by 22 µm deep channel defined by SU-8 photoresist (MicroChem). After treating with a silane release layer ...
-
Cat# 97599-22-9,
Inquire
Ask
Thomas R. Lane, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (22) was purchased from BOC Sciences (Shirley NY). Favipiravir was purchased from AdooQ Bioscience (Irvine ...
-
No products found
because this supplier's products are not listed.
BE Floyd, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Plants were grown for seven days under long day conditions (16hr light/8hr dark) at 22°C on nutrient solid half-strength Murashige-Skoog medium with vitamins (MSP09; Caisson Labs), 1% sucrose ...
-
No products found
because this supplier's products are not listed.
Emilie L. Cerezo, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Human EGF (Euromedex, Cat# HC88823), LJH685 (Selleck Chemicals ...
-
No products found
because this supplier's products are not listed.
Mikolaj J. Filon, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were dosed once daily with fenobam and once every other day with CTEP at 400 μL per 40g body weight by oral gavage with 22g 1.4” feeding needles with ball (Kent Scientific, catalog #FNC-22-1.5). Final drug concentrations were 24 mg/kg fenobam and 2 mg/kg CTEP ...
-
No products found
because this supplier's products are not listed.
Edward A. Partlow, et al.,
bioRxiv - Microbiology 2023
Quote:
... and human embryonic kidney (HEK)293T cells (ATCC) were propagated in DMEM (Cytiva) supplemented with 10% FBS (Atlas Biologicals). Calu-3 cells (ATCC ...