-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Bert Vanmechelen, et al.,
bioRxiv - Microbiology 2020
Quote:
... containing a multiple cloning site and a hammerhead ribozyme (HHRz) sequence between the T7 promoter and MARV trailer sequence (T7-HHRz-3M-eGFP-5M), was made by mutagenesis PCR using the site-directed mutagenesis kit (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Luyao Huang, et al.,
bioRxiv - Plant Biology 2023
Quote:
... the purified recombinant mCherry or Tip6ΔSP-mCherry proteins were separately mixed with purified His-ZmTPL2N-His proteins and incubated with pre-washed magnetic mCherry-Trap beads (Chromotek, Cat. No. rtmak) in wash buffer (0.2 M NaH2PO4/0.2 M Na2HPO4 ...
-
No products found
because this supplier's products are not listed.
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PAR (Trevigen and human #19) or magnetic beads conjugated with anti-Flag antibody (Sigma) ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
Maxime Batsch, et al.,
bioRxiv - Microbiology 2024
Quote:
... a 20x objective (Leica, HI PLAN I 20x/0,30 PH1, with P. putida-P. veronii, or a Nikon CFI S Plan Fluor ELWD 20XC MRH08230 ...
-
No products found
because this supplier's products are not listed.
Alina Remeeva, et al.,
bioRxiv - Biophysics 2021
Quote:
... with the mutation C85A and C-terminal 6×His tag) was obtained as a synthetic gene from Evrogen (Russia) and introduced into the pET11 expression vector (Novagen ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
Eun Young Jeong, et al.,
bioRxiv - Biochemistry 2024
Quote:
... human preadipocytes were seeded in 12-well plates (Cellvis) and cultured to confluency ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
GFP-expressing human embryonic kidney cells (i.e., GFP-HEK cells, GenTarget Inc.) were used as an RNP delivery cell model ...
-
No products found
because this supplier's products are not listed.
Nanami Sakata, et al.,
bioRxiv - Plant Biology 2022
Quote:
... L-His (Tokyo Chemical Industry), and L-Lys (Nacalai tesque ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... UAS-T7-DMiro-KK were generated by injecting pUAST-T7-DMiro-KK into flies by Bestgene Inc (Chino Hills ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 4°C and the supernatants were incubated overnight with 1/100 RNAPII or HIS antibodies (RNAP II AS11 1804, HIS AS20 4441, Agrisera) and 30 μl SureBeads (BioRad) ...
-
No products found
because this supplier's products are not listed.
Julian Schöllkopf, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
N-terminally His-tagged Pasteurella multocida toxin (PMT) was coated at 10 µg/mL (500 ng/well ...
-
No products found
because this supplier's products are not listed.
Larissa Kever, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli Gyrase (HIS) Supercoiling Assay Kit (Inspiralis, Norwich, UK) using 1 U of the respective gyrases and the same Cg1978 concentrations as for the C.g ...
-
No products found
because this supplier's products are not listed.
Ismael Hernandez-Nunez, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and using the T7 or SP6 RNA polimerases (NZYTech, Lisbon, Portugal). ISH was performed on cryostat sections (18 μm ...
-
No products found
Xuxiao He, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and Nickel Magnetic Beads for His tag protein purification (Bimake, B23602) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Andrew J. Stout, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or Beefy-R (Hi-Def B8 supplemented with 0.4 mg/mL RPI). Beefy-9 and Beefy-R were prepared immediately before use ...
-
No products found
because this supplier's products are not listed.
Advika Kamatar, et al.,
bioRxiv - Biophysics 2023
Quote:
... His-Clathrin was labeled with Atto594 NHS-ester (ATTO-TEC, Sigma-Aldrich) according to a previously published protocol (41 ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Surbhi Verma, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human MDMs (hMDMs) were isolated from human PBMCs and separated from healthy human donors’ blood using PolymorphPrep (PROGEN,1895) layering and centrifugation ...
-
No products found
because this supplier's products are not listed.
Gabrielle Brandt, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... recombinant human transferrin (InVitria), 80 μg/mL ...
-
No products found
because this supplier's products are not listed.
Daisuke Ogasawara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... N-term strep-His tag was first inserted into phCMV3 vector (Genlantis, cat # P003300) using Q5® Site-Directed Mutagenesis Kit (New England BioLabs ...
-
No products found
because this supplier's products are not listed.
Ana P. Peredo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Primary human AF cells obtained from healthy human tissue were purchased from Articular Engineering. AF cell lines AF26 (30-year-old donor) ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... human angiotensin II (HelloBio®); N-Methyl-D-Aspartate (NMDA ...
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St. Charles, MO, USA). MMP-9 Duoset ELISA was obtained from R&D Systems ...
-
No products found
because this supplier's products are not listed.
Erick Bermúdez-Méndez, et al.,
bioRxiv - Microbiology 2022
Quote:
... BSR-T7/5 monolayers (1.5 × 104 cells/well) were seeded on CultureWell 16 removable chambered coverglass (Grace Bio-Labs) and allowed to attach for at least 2 h at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Helen R. McPherson, et al.,
bioRxiv - Physiology 2021
Quote:
... Human FXIII-A2B2 from Zedira (Darmstadt, Germany) was further purified from contaminating albumin and glucose by Hiload 16/60 superdex 200 (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Mohita Tagore, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mouse anti-human GPHN (Synaptic Systems #147011); rabbit anti-human KRT17 (Sigma #HPA000452) ...
-
No products found
because this supplier's products are not listed.
M.A. Andres, et al.,
bioRxiv - Neuroscience 2022
Quote:
Human neural progenitor cells (hNPCs) (Neuromics, MN) were plated on Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Alicja Przybyszewska-Podstawka, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... TGFβ (human TGFβ1, Biorbyt, Cambridge, United Kingdom), Gibson Assembly® Master Mix (NEB) ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
Daniel R. Semlow, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... LacI with a C-terminal AviTag and biotin ligase were co-expressed in T7 Express Cells supplemented with 50 µM biotin from pET11a[LacR-Avi] and pBirAcm (Avidity) vectors ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Jamin Jung, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a spinning disk confocal microscope (UltraVIEW VOX, Perkin-Elmer) equipped with an oil immersion objective Plan-Apochromat 100x/1.57 Oil-HI DIC (Carl Zeiss) was used ...
-
No products found
because this supplier's products are not listed.
M Azharuddin, et al.,
bioRxiv - Immunology 2021
Quote:
... or anti-human IgA-HRP (Nordic BioSite, Täby, Sweden) was added to separate wells with diluted serum samples and incubated 90 min ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
WB, ELISA
Cat# CDC-41,
0.1 mg, Inquire
Ask
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... A375-Luc/iRFP (human melanoma, Creative Biogene CSC-RR0254), MCF7 (human breast cancer ...
-
No products found
because this supplier's products are not listed.
Piyakarn Boontem, Tetsumori Yamashima,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... rabbit anti-human activated μ-calpain antibody (PEPTIDE Institute, Japan) at 1:250 overnight ...
-
No products found
because this supplier's products are not listed.
Lorenz Thurner, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit anti human IL-1-Ra-Abs (antibodies-online # ABIN2856394) or mouse anti-human PGRN-Abs (abcam#ab169325 ...
-
No products found
because this supplier's products are not listed.
Yekyung Seong, et al.,
bioRxiv - Immunology 2021
Quote:
Anti-human CD11b (Clone M1/70, Leinco Technologies, Fenton, MO) was conjugated with Alexa Fluor 532 NHS ester according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rahul Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... T7-RILP proteins were expressed in Escherichia coli BL21 (500 μM isopropyl β-d-1-thiogalactopyranoside; Wisent Bioproducts; at room temperature for 16 hours) and purified using standard procedure in tris buffer [20 mM tris (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Martina Damo, et al.,
bioRxiv - Immunology 2020
Quote:
293T cells were cultured in complete DMEM (10% HI-FBS, 1x Pen/Strep) and then transfected using the LipoD293 Transfection reagent (SignaGen Laboratories, cat. SL100668) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lucia Pedicini, et al.,
bioRxiv - Cell Biology 2020
Quote:
... IDA data were searched against human database in ProteinPilot 4.5 (AB-SCIEX, Canada).
-
No products found
because this supplier's products are not listed.
Ragini Phansalkar, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... with probe for human TINAGL1(Advanced Cell Diagnostics #857221-C2) and OPAL 570 fluorophore (Akoya #FP1488001KT), following the manufacturer’s protocol.