-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5 μg of His-tagged H2A:H2B or His-H3:Flag-H4 (Diagenode) and 2 μg of Flag-hSpt16 were added to 250 μl of binding buffer (50 mM Tris-HCl pH 7.4 ...
-
This membrane protein is Human Integrin alpha 5 beta 1 (42-995(ITGA5)&21-728(ITGB1)). It has...
Cat# MP0245F,
1.0 case, Inquiry
Ask
Sumit Sen Santara, et al.,
bioRxiv - Immunology 2021
Quote:
... Siglec6-His tag (Creative Biolabs), 4μ8C ...
-
No products found
because this supplier's products are not listed.
Ye Qiu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody ...
-
No products found
because this supplier's products are not listed.
Antonin Weckel, et al.,
bioRxiv - Microbiology 2019
Quote:
... AMP concentrations were analyzed in the same supernatants by ELISA with the following kits: LL37 (Hycult,biotech), human beta defensin 1 (R&D, Novus) and human beta defensin 2 (Elabscience). The concentrations are reported as pg/mL medium ...
-
No products found
because this supplier's products are not listed.
Yujen Wang, et al.,
bioRxiv - Biophysics 2020
Quote:
... including 5mM CaCl2 (Human Alpha Thrombin, Enzyme Research Laboratories) to obtain a pre-gel fibrin solution ...
-
No products found
because this supplier's products are not listed.
Peder Fredlund Fuchs, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-integrin β5 (Abnova) 1:250 ...
-
No products found
because this supplier's products are not listed.
Siou-Luan He, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5 mg His-ubiquitin (BB-U-530, Boston Biochem), 2 mg purified MBP-KEG fusion protein (as E3 enzyme) ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences were used for probe visualization.
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Yu-Feng Chien, et al.,
bioRxiv - Bioengineering 2020
Quote:
... a TAG lens (TAG lens 2.5β, TAG Optics) was placed directly on top of an objective (UPLFLN 10XP, Olympus) to enable high-speed axial scan of the focus ...
-
No products found
because this supplier's products are not listed.
Adelaide Tovar, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... All animals were housed in groups of 1-5 on ALPHA-Dri bedding (Shepard) with ad libitum food (Envigo 2929) and water ...
-
No products found
because this supplier's products are not listed.
Paul G Donlin-Asp, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Beta actin and Psd95 (Stellaris, Biosearch technology) were diluted into 100ul hybridization buffer and incubated with cells for 4 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Quinton Smith, Christopher Chen, Sangeeta Bhatia,
bioRxiv - Bioengineering 2021
Quote:
Human intrahepatic biliary epithelial cells (IHCs) passage 1-5 (ScienCell, Carlsbad, CA) were cultured in complete epithelial growth media (ScienCell ...
-
No products found
because this supplier's products are not listed.
Lauren Rice, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% (v/v) (3-Aminopropyl) triethoxysilane (APTES) (98%, Alfa Aesar, USA) was added to coverslips in Milli-Q water and incubated for 15 min ...
-
No products found
because this supplier's products are not listed.
Steven J. Kunnen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... in INVITROGRO HI medium (BioIVT, #Z99009) supplemented with TORPEDO antibiotics mix (BioIVT ...
-
No products found
because this supplier's products are not listed.
Nina Le Bert, et al.,
bioRxiv - Immunology 2022
Quote:
... were coated with human IFN-γ antibody (1-D1K, Mabtech; 5 μg/ml) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Haijing Guo, Jen-Hsuan Wei, Joachim Seemann,
bioRxiv - Cell Biology 2020
Quote:
... 2 µM Phos-tag Biotin (ApexBio) and 2 ng/ml streptavidin-HRP (Jackson ImmunoResearch)] ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Jing Zhao, et al.,
bioRxiv - Plant Biology 2023
Quote:
... His-tag antibody (Tiangen, Beijing, China) and GST antibody (Tiangen).
-
No products found
because this supplier's products are not listed.
Frederik Fleissner, et al.,
bioRxiv - Biophysics 2020
Quote:
A plasmid coding for human vimentin containing a C-terminal His-tag (EX-D0114-B31, Tebu-bio, Germany) was transformed into E ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Satoshi Imanishi, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and the corresponding His tag (R06-32BH) were obtained from SignalChem Lifesciences (Richmond ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... or RBD-C tag (Dyadic International, Jupiter, FL) or different variants of spike protein B.1.1.7 (Alpha; Cube Biotech # 28718), B.1.351 (Beta ...
-
No products found
because this supplier's products are not listed.
Coralie Zangarelli, et al.,
bioRxiv - Genomics 2022
Quote:
A peptide corresponding to PgmL1 amino acid sequence 1 to 266 and carrying a C-terminal His tag was used for guinea pig immunization (Proteogenix). Sera were purified by antigen affinity purification to obtain highly specific α−PgmL1-GP antibodies (0.8 mg/mL) ...
-
No products found
because this supplier's products are not listed.
Sébastien Campagne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 60 mg/L of alpha-ketoisovaleric acid (13C5, 98%; 3-D1, 98%, Cambridge Isotope Laboratory). All the recombinant protein expressions were performed at 37°C during 4 hours in presence of 1 mM IPTG.
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 μl of 2 mM biotin-alkyne-tag (Click Chemistry Tools, 1266), and 5 μl of 200 mM CuSO4 were added in the specified order to 5 ml of PBS (pH 7.8) ...
-
Cat# HY-P70257-50 μg,
50 μg, USD $390.0
Ask
Shuangshuo Jia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and the autophagy inhibitor 3-methyladenine (3-MA; 5 mM; MedChemExpress) were applied to validate their respective effects.
-
No products found
because this supplier's products are not listed.
Nadejda Koloteva-Levine, et al.,
bioRxiv - Biochemistry 2020
Quote:
The Amyloid Beta (1-42) peptide (Aβ42) was purchased in 5 mg batches from Bachem (Germany). This was aliquoted in 0.5 mg stock batches and frozen at -20°C ...
-
No products found
because this supplier's products are not listed.
Nura A Mohamed, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... The precipitated sil@nanoMIL-89 was then re-suspended in 5 ml of human plasma from 3 separate donors (Cambridge Bioscience, UK). Solutions of sil@nanoMIL-89 were incubated at 37°C for 0 ...
-
No products found
because this supplier's products are not listed.
Marcin Poreba, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Fluorescent tags (Cyanine-5 NHS and Cyanine-7 NHS) were purchased from Lumiprobe (Hannover, Germany). Diazomethane was generated according to the Aldrich Technical Bulletin (AL-180 ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Nathalie Lecat-Guillet, et al.,
bioRxiv - Biophysics 2022
Quote:
The pcDNA plasmid encoding human mGlu2 with N-terminal FLAG- and SNAP-tags was a gift from Cisbio Bioassays (Perking Elmer ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Juan Jauregui-Lozano, et al.,
bioRxiv - Genomics 2021
Quote:
CUT&Tag was performed using CUTANA™ CUT&Tag reagents (Epicypher, Durham NC ...
-
No products found
because this supplier's products are not listed.
Marieta Caganova, et al.,
bioRxiv - Immunology 2022
Quote:
... DG75 cells with 5 μg/ml anti-human IgM (DIANOVA) for 3 min ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Jun Kunimatsu, Hidetoshi Amita, Okihide Hikosaka,
bioRxiv - Neuroscience 2023
Quote:
... a tungsten electrode (Alpha Omega Engineering or FHC) was lowered into the striatum through a guide tube using a micromanipulator (MO-97S ...
-
No products found
because this supplier's products are not listed.
David Welch, et al.,
bioRxiv - Biophysics 2021
Quote:
We used the 3-D human skin model EpiDerm-FT (MatTek Corp., Ashland, MA) which is derived from single adult donors ...
-
No products found
because this supplier's products are not listed.
Till Stephan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Spot tag (ChromoTek, Planegg-Martinsried, Germany), TOMM22 (Merck ...
-
No products found
because this supplier's products are not listed.
Adeel Ahmed, et al.,
bioRxiv - Bioengineering 2020
Quote:
... ports 3 and 5 were sealed using adhesive tape (Scotch brand, 3M, USA), and a second collagen solution (COL1 ...
-
No products found
because this supplier's products are not listed.
Marilena Poxleitner, et al.,
bioRxiv - Immunology 2023
Quote:
... and beta-amyloid (Clone Abeta 42, Synaptic Systems, Goettingen, Germany). Appropriate positive and negative controls were used to confirm the adequacy of the staining ...
-
No products found
because this supplier's products are not listed.
Karen E Hemmings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were treated with 5 μmol/L NucView™ 488 caspase-3 substrate (Biotium). Images were obtained in phase contrast and fluorescence mode using a x10 objective and an IncuCyte FLR time-lapse fluorescence microscope (Essen Bioscience) ...
-
No products found
because this supplier's products are not listed.
Eline Lemerle, et al.,
bioRxiv - Cell Biology 2022
Quote:
... myotubes were grown on alpha-numerically gridded bottom dishes (Ibidi, France). Adherent plasma membranes were obtained by sonication and were immediately immersed in 4% paraformaldehyde and the proteins of interest were then labeled by immunofluorescence in saturation buffer (1% BSA in KHMgE buffer) ...
-
No products found
because this supplier's products are not listed.
Mayis Kaba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Alpha Fluor 488 amine (20 μg/mL, AAT Bioquest/Cat No. 1705) was added at room temperature for 30 min with agitation before overnight incubation with hIgG ...