-
No products found
because this supplier's products are not listed.
Maria Maloverjan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the thiol group at 5′ end of ON was tagged with nanogold cluster (Monomaleimido Nanogold, Nanoprobes, NY, d = 1.4 nm) by forming a covalent bond between the thiol group of oligonucleotide and the maleimide group of label ...
-
No products found
because this supplier's products are not listed.
James Kaminski, et al.,
bioRxiv - Immunology 2023
Quote:
... and recombinant human IL-2 (rhIL2,50 U/mL; R&D Systems/CellGenix)) with or without 1% penicillin/streptomycin/l-glutamine (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Angela Ma, et al.,
bioRxiv - Microbiology 2022
Quote:
... and cytomegalovirus (D3 DFA Cytomegalovirus Immediate Early Antigen Identification kit, Quidel, San Diego, CA). IFA kits were used to test for enterovirus (D3 IFA Enterovirus Identification and Typing kit ...
-
No products found
because this supplier's products are not listed.
Yanzhao Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... The p24 antigen levels in viral supernatants were measured by an HIV-1 p24 antigen capture ELISA (XpressBio). Transfection efficiencies were normalized to the luciferase activity ...
-
No products found
because this supplier's products are not listed.
Federica De Marco, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Sugar quantification was assayed enzymatically (Enzytec™ Sucrose/D-Glucose/D-Fructose-R-Biopharm AG kit) (Vilaine et al. ...
-
No products found
because this supplier's products are not listed.
Yitzhak Reizel, et al.,
bioRxiv - Genetics 2020
Quote:
... and loaded into a 2100 Antigen Retriever (Proteogenix). After reaching the target temperature ...
-
No products found
because this supplier's products are not listed.
Sung Rye Park, et al.,
bioRxiv - Physiology 2020
Quote:
8-week-old C57BL/6J littermate male mice were separated into two groups and were fed on a regular chow diet (LFD group; Lab Diet, 5L0D) or high fat diet (HFD group; Bio-Serv, S3282). After 12 weeks of dietary modulation ...
-
No products found
because this supplier's products are not listed.
Jesse M. Hall, et al.,
bioRxiv - Microbiology 2021
Quote:
... Antigen specific antibody titers to PT (List Biological Laboratories #180) were measured by coating ELISA plates with 50 μl of antigen per well ...
-
No products found
Matthew T. Dickerson, et al.,
bioRxiv - Physiology 2022
Quote:
... Mouse and human islets were cultured in poly-d-lysine-coated 35mm glass-bottomed dishes (CellVis, Mountain View, CA) and all experiments were conducted within 48 hours.
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Arundhati Gupta, et al.,
bioRxiv - Microbiology 2021
Quote:
... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). PCR for the detection of the full-length ORF50 gene was performed using primers ORF50_del_for 5’GCTTCCTCGTCTACAGAGGTCAGG and ORF50_del_rev 5’GGCACCCATACTAAGTTGTGATTC ...
-
No products found
because this supplier's products are not listed.
Chantal T. Harris, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Blood from the tail vein of infected mice was collected in 200μL of 1x PBS and genomic DNA was isolated using the NZY Blood gDNA Isolation Kit (NZYTech), according to manufacturer’s guidelines (Extended Data Figure 7 ...
-
No products found
because this supplier's products are not listed.
Yuting Zeng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The human EDN enzyme-linked immunosorbent assay (ELISA) kit (MBL International 7630, Woburn, MA) has a minimum detection limit of 0.62 ng/mL ...
-
No products found
because this supplier's products are not listed.
Kouji Kobiyama, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 N antigen was detected by a monoclonal antibody 8G8A (Bioss Inc) and secondary antibody following antigen retrieval using autoclave in pH 9 citrate buffer.
-
No products found
because this supplier's products are not listed.
Ahan Dalal, et al.,
bioRxiv - Plant Biology 2019
Quote:
... we had six different experimental groups: three with ample irrigation (control–well irrigated, ICL-SW–well irrigated and ICL-NewFo1– well irrigated ...
-
No products found
because this supplier's products are not listed.
Arvind Iyer, et al.,
bioRxiv - Genomics 2019
Quote:
... Red blood cells were first removed with the addition of red blood cell (RBC) lysis buffer (G-Bioscience, St. Louis, MO, USA) and incubation for 10 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Laura M. Chambers, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and OV81 (human) EOC cell lines were cultured in Dulbecco Modified Eagle Medium (DMEM) media containing heat inactivated 5% FBS (Atlas Biologicals Cat # F-0500-D, Lot F31E18D1) and grown under standard conditions ...
-
LC Laboratories' Product Number G-5200 - Genistin (Genistein 7-O-β-D-glucopyranoside), >99% -...
Cat# G-5200, SKU# G-5200_250mg,
250 mg, $171.00
Ask
Na Zhao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... docetaxel (LC Laboratories #D-1000) was first dissolved in Tween 80 and then diluted 1:4 with 16.25% ethanol and administered at 10 mg/kg weekly ...
-
No products found
because this supplier's products are not listed.
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PAR (Trevigen and human #19) or magnetic beads conjugated with anti-Flag antibody (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vidyanand Anaparti, et al.,
bioRxiv - Physiology 2019
Quote:
... C-reactive protein (CRP) levels were measured using a human high-sensitivity CRP (hs-CRP) ELISA kit (Biomatik, Canada) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chuyun Chen, et al.,
bioRxiv - Bioengineering 2022
Quote:
The fragments of the group II intron in Clostridium tetani (CTE) and IRES sequences were chemically synthesized from GENEWIZ, and selected mutations were introduced in the synthesis to make it recognize different exons ...
-
No products found
because this supplier's products are not listed.
Austin J. Graham, et al.,
bioRxiv - Microbiology 2021
Quote:
... isopropyl ß-D-1-thiogalactopyranoside (IPTG, Teknova), kanamycin sulfate (C18H38N4O15S ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Jonathan Richard, et al.,
bioRxiv - Immunology 2021
Quote:
... and 1mM dithiothreitol) and 50μl of 1mM d-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory concentration (IC50 ...
-
No products found
because this supplier's products are not listed.
Justine C. Shiau, et al.,
bioRxiv - Microbiology 2024
Quote:
... Female mosquitos were provided with human whole blood (Interstate Blood-Bank, Memphis, TN) with glass membrane feeders (Chemglass Life Sciences, NJ) to support egg production ...
-
No products found
because this supplier's products are not listed.
Anna V Vaaben, et al.,
bioRxiv - Immunology 2022
Quote:
... Umbilical cord blood was collected at the time of delivery using umbilical cord blood collection kits (Pall Medical) and an aliquot of whole cord blood was preserved in RNAlater (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Sinéad Kinsella, et al.,
bioRxiv - Immunology 2023
Quote:
... Gasdermin D was measured in freshly isolated thymocytes using Gasdermin D (mouse) ELISA Kit (Adipogen Life Sciences, AG-45B-0011-KI01). Lactate dehydrogenase was assessed from the supernatant of harvested thymocytes using Lactate Dehydrogenase assay (Abcam ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Nalin H. Maniya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
We received Glioblastoma and control group samples from Precision for Medicine. An approved IRB protocol is already in place at Precision for the collection of plasma samples from patients ...
-
No products found
because this supplier's products are not listed.
Elahe Zarini-Gakiye, et al.,
bioRxiv - Neuroscience 2020
Quote:
... were mechanically isolated (after snap freezing in liquid nitrogen) from each experimental groups and total RNA was extracted using an easy-BLUE total RNA extraction kit (iNtRON Biotechnology, South Korea) and resolved in 50μl DEPS water ...
-
No products found
because this supplier's products are not listed.
Youri G Bolsius, et al.,
bioRxiv - Neuroscience 2021
Quote:
... both experimental groups were immediately sacrificed and the brains were impregnated using the Rapid Golgi stain kit (FD Neurotechnologies Inc., Columbia, MD, USA) and coronal 80μm thick hippocampal sections were prescreened to find neurons qualified for spine analysis ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Shaymaa Bahnassy, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... antigen-antibody complexes were detected by the chemiluminescence WesternBright ECL Detection Reagent (Advansta) and imaged using the Amersham Imager 600 (GE Healthcare Life Sciences).
-
No products found
because this supplier's products are not listed.
Julia Craft, et al.,
bioRxiv - Microbiology 2021
Quote:
... Total DNA was isolated from individual colonies using mini-genomic DNA kit for blood and cultured cells (IBI Scientific). Putative E ...
-
No products found
because this supplier's products are not listed.
Cesare Granata, et al.,
bioRxiv - Physiology 2019
Quote:
... Stages were interspersed with 30-s breaks for the measurement of fingertip capillary blood lactate concentration using a pre-calibrated blood-lactate analyzer (YSI 2300 STAT Plus, YSI, USA). Participants were instructed to keep a cadence above 60 rpm and were only allowed access to cadence and elapsed time ...
-
No products found
because this supplier's products are not listed.
Kaetlyn T. Ryan, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... milbemycin D (Toronto Research Chemicals), moxidectin (TCI America) ...
-
No products found
because this supplier's products are not listed.
Emmeran Le Moal, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The Fmoc protecting group was removed by treating resin twice with 20% piperidine (Chem Impex International, 02351) in N,N-dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Alexander M Pham, et al.,
bioRxiv - Microbiology 2022
Quote:
... or a fluorescent Cell Meter™ Cellular Senescence Activity Assay Kit with Xite™ Red beta-D-galactopyranoside (AAT Bioquest) according to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Emilie L. Cerezo, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Human EGF (Euromedex, Cat# HC88823), LJH685 (Selleck Chemicals ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Laura R.H. Ahlers, et al.,
bioRxiv - Microbiology 2019
Quote:
... groups of at least 40 flies were injected and kept in vials containing cornmeal food (Genesee Scientific #66-112). DGRP survival curves were repeated to verify reproducibility ...
-
No products found
because this supplier's products are not listed.
Sahil Batra, Ashok Kumar, Balaji Prakash,
bioRxiv - Biochemistry 2020
Quote:
Guanosine nucleotides labeled with fluorescent N-methyl-anthranoyl (mant) groups O-linked with 2’ or 3’ of ribose (Jena Biosciences), were used for binding studies ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human DARPP-32 isoforms purified from NSCLC cells were incubated with kinase-activated human IKKα protein (SignalChem) for in vitro kinase assays by following previously described methods70 ...
-
No products found
because this supplier's products are not listed.
Jesse R. Holt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Experiments were performed in Cnt-Pr-D (CellnTec) culture media with added 1.2 mM Ca2+ ...
-
No products found
because this supplier's products are not listed.
Aleksandar Janjic, et al.,
bioRxiv - Genomics 2021
Quote:
Peripheral blood mononuclear cells (PBMCs) were obtained from LGC Standards (PCS-800-011). Before use ...
-
No products found
because this supplier's products are not listed.
Moeez Rathore, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... supplemented with 10% human serum (Atlanta Biologicals) and antibiotics-antimycotic (1x ...
-
No products found
because this supplier's products are not listed.
Maciej Kliszczak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-human FAM111B (HPA038637, Atlas Antibodies) at 1:1000 (IB and IF) ...
-
No products found
because this supplier's products are not listed.
Simona Selberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant human FTO protein was labeled with His-tag using Monolith His-Tag Labeling Kit RED-tris-NTA (NanoTemper Technologies GmbH; MO-L008). The labelled FTO protein (target ...
-
No products found
because this supplier's products are not listed.
Alessandro Manenti, et al.,
bioRxiv - Immunology 2020
Quote:
... The human monoclonal antibody IgG1-CR3022 (Absolute Antibody) and the human monoclonal antibody IgG1 SAD-S35 (Acrobiosystem ...