-
No products found
because this supplier's products are not listed.
Hannah L. Dela Cruz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Recombinant human (rh)ASIP (R&D Systems, 9094-AG) was prepared in aCSF.
-
No products found
because this supplier's products are not listed.
Danielle E Anderson, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti flavivirus group antigen antibody (Millipore, MAB10216). The blots were developed by HRP reaction and imaged with a ProteinSimple FluorChem imaging system.
-
No products found
because this supplier's products are not listed.
J. Stone Doggett, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2019
Quote:
... and incubated with primary antibody (Rabbit Anti-Group D antigen, Thermo Scientific Singapore) or Guinea Pig Anti-EbpC 45 at 1:500 dilution for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Qiankun Wang, Liang Shan,
bioRxiv - Microbiology 2023
Quote:
... Human CD34+ cells were isolated from cord blood using EasySep™ human cord blood CD34 positive selection kit II (STEMCELL Technologies #17896), which were then cryopreserved in Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
No products found
because this supplier's products are not listed.
Shanaz Ghandhi, et al.,
bioRxiv - Genomics 2019
Quote:
... using antibodies specific to human blood cell surface antigens for CD45 (Biolegend, catalog# 103115), CD3 (Biolegend ...
-
No products found
because this supplier's products are not listed.
Atossa C. Ghorashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... or mouse-anti-human blood group Lewis a clone 7LE (Abcam, catalog no. ab3967). For staining with fucose-binding protein Aleuria aurantia lectin (AAL) ...
-
No products found
because this supplier's products are not listed.
Russell Hughes, et al.,
bioRxiv - Immunology 2024
Quote:
... Primary human T-cells were isolated from peripheral blood (NHS Blood & Transplant Service, UK) using Ficoll-PaqueTM (Merck Group, Darmstadt, Germany) density gradient centrifugation followed by positive selection using antibody-coated magnetic beads directed against either human CD4 or CD8 antigen (Miltenyi Biotechnology ...
-
No products found
because this supplier's products are not listed.
Mengjia Song, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rabbit anti-human ICAM1 (Proteintech Group, 1:400), rabbit anti-human CD133 (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Stephen A. Vella, et al.,
bioRxiv - Microbiology 2020
Quote:
... gondii tachyzoites (RH strain) were maintained in hTERT human fibroblasts (BD Biosciences) using Dulbeco’s modified essential media (DMEM ...
-
No products found
because this supplier's products are not listed.
Laura Díaz-Alvarez, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant human (rh) M-CSF was from PeproTech (Cranbury, NJ). Lymphoprep was from Axis-Shield PoC AS (Oslo ...
-
No products found
because this supplier's products are not listed.
Rodolfo Urbano, et al.,
bioRxiv - Immunology 2022
Quote:
... Primary human intestinal myofibroblast (Lonza Group AG, CC-2902) were maintained in SmGM Medium with growth factors (Lonza Group AG) ...
-
No products found
because this supplier's products are not listed.
Jelke J. Fros, et al.,
bioRxiv - Microbiology 2021
Quote:
... Human blood (Sanquin Blood Supply Foundation ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... sorted B cells were cultured with rh IL-21 as previously described and with Human CD40-Ligand Multimer Kit (1 µg/mL, Miltenyi Biotec), rh IL-6 (20 ...
-
No products found
because this supplier's products are not listed.
Julia L. McKechnie, et al.,
bioRxiv - Immunology 2019
Quote:
... flavivirus group antigen (4G2, Novus Biologicals) conjugated to Alexa Fluor™ 647 using Alexa Fluor 647 Antibody Labeling Kit (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Sofie Mohlin, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Immunohistochemistry on human (antigen retrieval by Target Retrieval Solution pH6.0 (DAKO #S1699)) and mouse fetal tissue was performed using Autostainer (Dako ...
-
No products found
because this supplier's products are not listed.
Peng Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Human peripheral blood mononuclear cells (PBMCs) were isolated from fresh human peripheral blood using Ficoll (GE Healthcare) density gradient centrifugation ...
-
No products found
because this supplier's products are not listed.
Beiyuan Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... After antigen retrieval using Antigen Unmasking Solution (Vector Laboratories), tissue slides were blocked with 10% Goat Serum (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Yasmina Curto, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche, Welwyn Garden City, UK) or placebo (PL ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
... Recombinant homodimeric human (rh) E-selectins (Sino Biological) were deposited on the inner surface of the microfluidic chambers by incubating with 20 μl of the rh E-selectin (0.5 – 4 μg ml-1 ...
-
No products found
because this supplier's products are not listed.
Kristine L Werling, et al.,
bioRxiv - Microbiology 2022
Quote:
... and human blood sourced from BioIVT. Two days after each blood feeding ...
-
No products found
because this supplier's products are not listed.
Hugo Bisio, et al.,
bioRxiv - Cell Biology 2021
Quote:
... was prepared from tachyzoites of RH or RH ΔKu80 (here referred as Δku80) strains using the Wizard SV genomic DNA purification (Promega) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Srinivasan Sivanandan, et al.,
bioRxiv - Genomics 2023
Quote:
NucleoSpin Blood kit (Macherey-Nagel, 740951.50) was used to isolate the genomic DNA ...
-
No products found
because this supplier's products are not listed.
Murilo Delgobo, et al.,
bioRxiv - Immunology 2019
Quote:
... Recombinant human (rh) IL-6 was purchased from Immunotools. Anti-IFNAR2A (clone MMHAR-2 ...
-
No products found
because this supplier's products are not listed.
William J. Moss, et al.,
bioRxiv - Microbiology 2021
Quote:
... Genomic DNA (Toxoplasma RH derivatives) was extracted for PCR using a Monarch Genomic DNA Purification Kit (New England Biolabs). Q5 Polymerase (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
Bjoern Meyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gag p24 antigen concentration was measured with the Alliance HIV-1 p24 Antigen ELISA kit (Perkin Elmer).
-
No products found
because this supplier's products are not listed.
Julia Kazmierski, et al.,
bioRxiv - Immunology 2021
Quote:
... Group 2 (France, Illumina), Group 3 (North America ...
-
No products found
because this supplier's products are not listed.
Hui Ma, et al.,
bioRxiv - Immunology 2021
Quote:
... Primary antibodies against human antigens for immunohistochemistry were mouse monoclonal clone D-1 against IgG at 1:100 dilution (Santa Cruz Biotech) and rabbit polyclonal ab5103 against histone 3 (citrulline R2+R8+R17 ...
-
No products found
because this supplier's products are not listed.
Kalani Gayathri Jayasekera, et al.,
bioRxiv - Microbiology 2023
Quote:
... NS1 antigen levels were measured using the Platelia™ Dengue NS1 Antigen kit (Cat No. 72830, Bio-Rad, France) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bei-di Chen, et al.,
bioRxiv - Microbiology 2019
Quote:
... Antigen-specific IgG ELISpot assays were performed using Human IgG ELISpotBASIC kit (MabTech). PBMCs were first pre-stimulated with a mixture of R848 at 1 μg/ml and rhIL-2 at 10 ng/ml for 96h ...
-
No products found
because this supplier's products are not listed.
Andrew S. Flies, et al.,
bioRxiv - Immunology 2020
Quote:
... pSBtet-RH (Addgene # 60500) were gifts to Addgene from Eric Kowarz 77 ...
-
No products found
because this supplier's products are not listed.
Huazhi Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... total RNA of midgut samples in treatment groups and control groups were respectively extracted using AxyPrep™ Multisource Total RNA Miniprep Kit (TaKaRa, Japan); (2 ...
-
No products found
because this supplier's products are not listed.
Juliett Anders, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human erythrocytes (blood group 0+ donated from the blood bank of the University Medical Center Hamburg-Eppendorf) and trophozoites to be examined were washed twice with incomplete TY-I-S-33 medium (200 x g ...
-
No products found
because this supplier's products are not listed.
Carmen Camara, et al.,
bioRxiv - Immunology 2021
Quote:
The ACCESS SARS-CoV-2 CLIA (Beckman Coulter Inc., California, USA) was used for semiquantitative detection of IgG directed against S protein RBD using serum obtained from venipuncture blood ...
-
No products found
because this supplier's products are not listed.
Tatsuya Ikuta, et al.,
bioRxiv - Biophysics 2020
Quote:
The Rh-PDE (full) gene (NCBI Gene ID: 16078606) was synthesized after human codon optimization (GenScript), as described previously13 ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Oda, et al.,
bioRxiv - Immunology 2022
Quote:
... Quantifoil R1.2/1.3 Cu/Rh 200 mesh (Quantifoil Micro Tools GmbH ...
-
No products found
because this supplier's products are not listed.
Mengyao Wang, et al.,
bioRxiv - Immunology 2022
Quote:
Goat blood RNA was extracted by blood total RNA extraction kit (TIANGEN, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anastasia-Maria Zavitsanou, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... antigen retrieval was performed using antigen retrieval buffer pH=6 (Leica) for 20min ...
-
No products found
because this supplier's products are not listed.
Ioannis Kanakis, et al.,
bioRxiv - Physiology 2020
Quote:
... from all the experimental groups (n=3/group) was subjected to bisulphite treatment using the EZ DNA methylation™ kit (Zymo Research, USA) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Hoai Thi Thu Tran, et al.,
bioRxiv - Microbiology 2021
Quote:
... Luminescence was detected within 1h using the one-step luciferase reagent from BPS following the manufacturer’s protocol in a multiplate reader from Tecan (Tecan Group Ltd, Crailsheim, Germany).
-
No products found
because this supplier's products are not listed.
V Lambert, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Immunofluorescence used anti–human nuclear KU80 antigen (Cell signaling Technology, C48E7) or anti human mitochondria antibody (anti-CoxIV ...
-
No products found
because this supplier's products are not listed.
Kai Xia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Testosterone levels were measured using a chemiluminescent immunoassay (CLIA) system (Architect system; Abbott GmbH & Co. KG, Germany). The coefficient of variation of this CLIA system is 1.9–5.1% for intra-assay precision and 2.5–5.2% for inter- assay precision ...
-
No products found
because this supplier's products are not listed.
Kok-Siong Chen, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Antigen retrieval was performed using an antigen decloaking chamber (Biocare Medical, Pacheco, California). Mounted sections were heated to 125°C for 4 minutes at 15 psi in 10 mM sodium citrate buffer (pH 6.0 ...
-
No products found
because this supplier's products are not listed.
Matthew A. Schaller, et al.,
bioRxiv - Microbiology 2021
Quote:
... serum from humans with AB blood group (HP1022; Valley Biomedical) was added to the samples to block non-specific binding ...
-
No products found
because this supplier's products are not listed.
Mahla Poudineh, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and blood was collected in serum tubes (Starstedt) for analysis with a commercial human ELISA kit (Mercodia).
-
No products found
because this supplier's products are not listed.
Adam J. Widman, et al.,
bioRxiv - Genomics 2022
Quote:
... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
No products found
because this supplier's products are not listed.
Zeqing Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Antigen retrieval was performed with Antigen Retrieval Solution (Solarbio, C1035) before the conventional immunostaining procedure.
-
No products found
because this supplier's products are not listed.
Chiara Foresti, et al.,
bioRxiv - Genetics 2023
Quote:
... and a d-gluconic acid/d-glucono-δ-lactone assay kit (Megazyme International), were used according to the manufacturer’s instructions 1 g of berry pericarp powdered material was diluted in 10 mL of buffer containing 500 µL Carrez 1 solution ...
-
No products found
because this supplier's products are not listed.
Nils H. Rustmeier, et al.,
bioRxiv - Biochemistry 2023
Quote:
... proteins were incubated with oligosaccharides (Forssman antigen trisaccharide: Elicityl, France; Blood group A trisaccharide: Biosynth, UK) for 5 minutes prior to their addition to the cellular samples (∼1×106 cells in 100 µL) ...