-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Srideshikan Sargur Madabushi, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The mouse and humanized anti-human CD33 mAb were conjugated with the metal chelator 1,4,7,10-tetraazacyclododecane-N,N′,N′′,N′′′-tetraacetic acid (NHS-DOTA; Macrocyclics, Dallas, TX) as previously described (12) ...
-
Cat# BBF-05196,
Inquire
Ask
Minjoo Kim, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The resulting whole cell lysate was then tumbled with N,N-dimethyl-N-dodecylglycine (Empigen BB Detergent, BOC Sciences) (3% v/v ...
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Erika H. Dawson, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... n-tetracosane and n-hexatriacontane at 0.1 µg/mL concentration (both CDN Isotopes), both fully deuterated to enable spectral traceability and separation of internal standards from ant-derived substances ...
-
No products found
because this supplier's products are not listed.
Hannah J. Larsen, et al.,
bioRxiv - Physiology 2022
Quote:
... Arachidonic Acid (P/N 390) and ADP (P/N 384) were purchased from Chrono-Log Corporation ...
-
No products found
because this supplier's products are not listed.
Shanna Romand, et al.,
bioRxiv - Plant Biology 2021
Quote:
... or nitrogen limiting (-N) (+N medium diluted 1/25 in 0.5X Murashige and Skoog medium without nitrogen [Caisson Labs] ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology, LVR-1046) to create the final lentiviral plasmid pLV-CMV-GCaMP6s-P2A-TACR1-T2A-hG15-PGK-Hyg ...
-
No products found
because this supplier's products are not listed.
Simona Iftimie, et al.,
bioRxiv - Microbiology 2020
Quote:
... Tests were carried out with the VIASURE SARS-CoV-2 Real Time PCR Detection Kit that detects ORF1ab and N genes (CerTest Biotec, Zaragoza, Spain). RNA was extracted in a QIAcube apparatus with RNeasy reagents (Qiagen N.V. ...
-
No products found
because this supplier's products are not listed.
Samuel T. Bailey, et al.,
bioRxiv - Physiology 2022
Quote:
... Samples were collected and homogenized in large groups (N=60 males and N=20 females) and homogenized using a BeadBlaster 24 microtube homogenizer (Benchmark Scientific, Edison, NJ, USA). Soluble protein was measured using the Bradford method (BioRad ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Guizhen Fan, et al.,
bioRxiv - Biophysics 2022
Quote:
... Membranes were probed with a rabbit polyclonal antibody against the C-terminal 19aa of IP3R1 (CT1; #ARC154, Antibody Research Corporation) at a 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Huayin Wu, et al.,
bioRxiv - Biophysics 2019
Quote:
... with PEG using an EDC/NHS reaction to covalently link amine-terminal 2 kDa PEG (Rapp Polymere GmbH, Tuebingen, Germany) to the carboxyl groups on the microsphere surface as previously described (20) ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-human TFAM (1:1000, PhosphoSolutions, Catalog# 1999-hTFAM), Anti-mouse TFAM (1:1000 ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
Cat# KIT-27-Ahu25,
25 micrograms,USD $580.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... anti-p75 conjugated saporin (p75-saporin) or IgG-saporin control (n = 8 / group, Advanced Targeting Systems) was diluted to final concentration of 0.4 mg/ml in normal saline ...
-
No products found
because this supplier's products are not listed.
Bojana Kokinovic, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with LUMPlanFL N 40x/0.8w water immersion objective and Prime BSI Express sCMOS camera (Teledyne Photometrics). CoolLED pE-300 was used as a source of green/blue light ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant human interleukin-12 (IL-2) was gifted from Akron Biotech. Recombinant human interleukin-15 (IL-15 ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Shan Zhao, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 200 mM SDS and 25% w/v N-Methyldiethanolamine) at 37 °C on a shaking rocker (IKA, 2D digital). The solutions were refreshed when the color changed to green until colorless ...
-
No products found
because this supplier's products are not listed.
Julio García-Villalba, et al.,
bioRxiv - Immunology 2022
Quote:
... GSDMD and P2X7 were also tested by ELISA (Cusabio for ASC and P2X7, Aviva System Biology for GSDMD and Arigo Biolaboratories for HMGB1). Results were read in a Synergy Mx (BioTek ...
-
No products found
because this supplier's products are not listed.
Caroline S. Cencer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CL4 and CACO-2BBE cells were grown to n days post-confluent (DPC) on acid-washed 22×22 mm #1.5H coverslips (Globe Scientific) in a 6-well plate to a time point with apical polarity representative of their native tissue ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Anna M.R. Hayes, et al.,
bioRxiv - Physiology 2022
Quote:
Juvenile male and female rats (n=9 per sex) were given daily amounts of acesulfame potassium (ACE-K group; catalog # A2815, Spectrum Chemical, Gardena ...
-
No products found
because this supplier's products are not listed.
Cody A. Cushing, et al.,
bioRxiv - Neuroscience 2023
Quote:
... measured by the Behavioral Activation Scale (BAS) and Eysenck Personality Questionnaire-Neuroticism (EPQ-R-N) (Carver & White, 1994; Eysenck & Eysenck, 1993). Participants were ineligible if meeting any of the following criteria ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Jyoti Kundu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Pre-stained protein ladder was procured from Real Biotech Corporation ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Mean-Hwan Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 350 µm thick human cortical slices were prepared using a Compressome VF-300 (Precisionary Instruments) or VT1200S (Leica Biosystems) ...
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... VWF antigen (Ag) (N: 50-150 IU/dL) was measured using the automated STA-Liatest VWF:Ag® (Diagnostica Stago, Asnières-sur-Seine, France). ADAMTS13 activity (N ...
-
No products found
because this supplier's products are not listed.
Vivek Jani, et al.,
bioRxiv - Biophysics 2023
Quote:
... incubated for 1 minute in rigor buffer with the fluorescent ATP analog 25 μM 2’-/3’-O-(N’-Methylanthraniloyl) adenosine-5’-O-triphosphate (a.k.a. mant-ATP, Enzo Life Sciences, Axxora LLC, Framingham, NY), and moved to room temperature relaxing buffer ...
-
No products found
because this supplier's products are not listed.
Ayodeji B. Oyenihi, et al.,
bioRxiv - Microbiology 2024
Quote:
... Historical vaginal specimens (n = 946) marked for disposal were received in OneSwab® (Copan Diagnostics, CA, USA) or ThinPrep® (Hologic, MA, USA) transport media in a Clinical Laboratory Improvement Amendments (CLIA)-certified infectious disease laboratory facility between January and June 2023 and stored at −80 °C were selected randomly for this study ...
-
DA agonist
Sold for research purposes only.
Cat# 1023.0, SKU# 1023-10 mg,
Inquire
Ask
Daniel J. Steinberg, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2.5µg/ml human recombinant Insulin (Biological Industries; 41-975-100) and 3µM CHIR-99021 (Axon Medchem ; 1386) sterilized through 0.22μm filter ...
-
No products found
because this supplier's products are not listed.
Alina Sigaeva, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human colon adenocarcinoma HT-29 cells were routinely cultured in Dulbecco’s Modified Eagle’s Medium (Cellutron Life Technologies, USA) with a high glucose concentration ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
Proteins were separated on 4-20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours ...
-
No products found
because this supplier's products are not listed.
Marco Losa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were dispensed at various volumes into human ASC-coated 1,536-well plates using contactless dispensing with an ECHO 555 Acoustic Dispenser (Labcyte). Thereby ...
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Weigao Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 300 μL pure protein solution was added to a 1 mm pathlength quartz cuvette (Starna Cells, USA). The scanning wavelength starts from 300 nm and ends at 190 nm ...
-
No products found
because this supplier's products are not listed.
Shoupeng Wei, et al.,
bioRxiv - Neuroscience 2023
Quote:
Hito Golgi-Cox Kit (Hitobiotec Corp., Wilmington, DE, USA) was used to reveal the structure and density of dendritic spines in the mPFC37–39 ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Cassandra Velasco, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PCR master mixes were decontaminated with double-stranded DNAse treatment (PCR decontamination kit, Arcticzymes, Tromsø, Norway). Sterile water was processed using the same procedure as a negative control ...
-
No products found
because this supplier's products are not listed.
Rowena Schultz, et al.,
bioRxiv - Cell Biology 2020
Quote:
... every 20th slide was stained with periodic acid-Schiff-hematoxylin (K047 kit, Poly Scientific RD, Bayshore NY USA) to show basal laminar deposit ...