-
No products found
because this supplier's products are not listed.
Pirunthan Perampalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cytokeratin (human specific cytokeratin 7 and 8, ZETA Corporation #Z2018ML, 1:200), EpCAM (Cell Signaling Technologies ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Daniela Fraccarollo, et al.,
bioRxiv - Immunology 2021
Quote:
... Serum samples were screened for CMV-specific IgG antibodies with the CMV-IgG-ELISA PKS Medac enzyme immunoassay (115-Q-PKS; Medac Diagnostika), using a cut-off value of >0.55 AU/mL for defining seropositivity according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Sofia Rossini, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... while recombinant human IDO1 protein was obtained by Giotto Biotech. Construct expressing murine Src was obtained from Origene.
-
No products found
because this supplier's products are not listed.
Stefania Zuppone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an in-house sandwich enzyme linked immunoassay (ELISA) kit (HansaBioMed Life Sciences), following the manufacturer’s protocol provided with the kit ...
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ho-Shiang Huang, Chan-Jung Liu,
bioRxiv - Biochemistry 2021
Quote:
Commercial kits were used to determine the urine level of NGAL (NGAL ELISA Kit, BioPorto Diagnostics A/S, Copenhagen, Denmark) and the urine levels of stone-induced renal tubular damage markers ...
-
No products found
because this supplier's products are not listed.
Tamás Bakos, et al.,
bioRxiv - Immunology 2024
Quote:
... Soluble terminal C complex (sTCC, sC5b9) was measured with an ELISA kit from Svar Life Science AB (Malmö ...
-
No products found
because this supplier's products are not listed.
Chuan Xu, et al.,
bioRxiv - Immunology 2023
Quote:
Rabbit polyclonal antibodies against human or murine IFNε proteins were generated by using peptides derived from IFNε protein sequences (Lampire Biological Laboratories (Pipersville, PA). The specificity of antibodies was determined by western blot analysis ...
-
No products found
because this supplier's products are not listed.
Bingbing Yu, Yifan Chen, Yan Yan, Bin Zhu,
bioRxiv - Molecular Biology 2023
Quote:
... and incubated with dsRNA-specific J2 mAb (SCICONS) for 30 min at 25°C ...
-
No products found
because this supplier's products are not listed.
Guangchun Han, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Tobacco-specific carcinogen (nicotine-specific nitrosamine ketone; NNK) with a purity of 99.96% by HPLC was purchased from TargetMol (Wellesley Hills, MA). Tamoxifen ...
-
No products found
because this supplier's products are not listed.
Timothy A Fenton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Species-specific fluorophores-conjugated IgG (1:500; Thomas Scientific) was used as secondary antibodies (45 minutes ...
-
No products found
because this supplier's products are not listed.
Gabrielle Brandt, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... recombinant human transferrin (InVitria), 80 μg/mL ...
-
No products found
because this supplier's products are not listed.
Benjamin H Gern, et al.,
bioRxiv - Immunology 2019
Quote:
... Antibody detection was performed using species specific polymer HRP-conjugated systems (GBI Labs) coupled with tyramide signal amplification (TSA ...
-
No products found
because this supplier's products are not listed.
Sabarish Ramachandran, et al.,
bioRxiv - Cancer Biology 2021
Quote:
[2,3-3H]-L-Serine (specific radioactivity, >5 Ci/mmol) was purchased from Moravek, Inc ...
-
No products found
because this supplier's products are not listed.
Andrew R. McEwan, et al.,
bioRxiv - Genetics 2021
Quote:
... from human DNA (Cambio, UK) using the following primers ...
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Helen R. McPherson, et al.,
bioRxiv - Physiology 2021
Quote:
... Human FXIII-A2B2 from Zedira (Darmstadt, Germany) was further purified from contaminating albumin and glucose by Hiload 16/60 superdex 200 (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
No products found
Eun Young Jeong, et al.,
bioRxiv - Biochemistry 2024
Quote:
... human preadipocytes were seeded in 12-well plates (Cellvis) and cultured to confluency ...
-
This kit is a sandwich ELISA assay for the quantitative measurement of ACAT1 in human serum,...
Cat# KITE1066,
Inquiry
Ask
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... A375-Luc/iRFP (human melanoma, Creative Biogene CSC-RR0254), MCF7 (human breast cancer ...
-
No products found
because this supplier's products are not listed.
Lesia Rodriguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... the protein samples were separated by 12% SDS-PAGE and analyzed by immunoblot with anti-ROP2 specific antibody (1:10,000, Abiocode). Input samples were isolated from total protein extracts ...
-
No products found
because this supplier's products are not listed.
Chloé Alexandra Morel, et al.,
bioRxiv - Microbiology 2023
Quote:
... Images were collected from Back scattered electron with a specific BSE Detector (On point - Gatan Inc., Pleasanton, CA, USA) using the software Digital Micrograph (Gatan) ...
-
No products found
because this supplier's products are not listed.
Neetu Singh Kushwah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
AAE3 protein sequences from Medicago truncatula (GenBank ...
-
No products found
because this supplier's products are not listed.
Piyakarn Boontem, Tetsumori Yamashima,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... rabbit anti-human activated μ-calpain antibody (PEPTIDE Institute, Japan) at 1:250 overnight ...
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... and human embryonic kidney 293T cells were purchased from Genhunter Corp ...
-
No products found
because this supplier's products are not listed.
Mutsumi Kobayashi, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Human iPSCs were dissociated using Accutase (Innovative Cell Technologies, AT104) and suspended in mTeSR plus (Stemcell Technologies ...
-
No products found
because this supplier's products are not listed.
Nina T. Lichtenberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with a specific food reward, sucrose (20%, 0.1 mL/delivery) or grain pellets (1 45 mg pellet/delivery; Bio-Serv). CS-reward pairings were counterbalanced at the start of each experiment ...
-
No products found
because this supplier's products are not listed.
Beiyuan Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... in which guide RNA contains crRNA with specific DNA target sequence and tracrRNA labeled with ATTO™ 550 (ATTO-TEC). Two crRNAs targeting SIX4 (ACAACTCCACTCGGAACTTC and CCTCGCACACGCAGGCGACA ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Leila M. Allen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Drill holes were made in the appropriate regions according to the specific RatHat build using a surgical drill (OmniDrill 3S, World Precision Instruments). Dura mater was ruptured at the implant sites using a 32-gauge needle ...
-
No products found
because this supplier's products are not listed.
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
GFP-expressing human embryonic kidney cells (i.e., GFP-HEK cells, GenTarget Inc.) were used as an RNP delivery cell model ...
-
No products found
because this supplier's products are not listed.
Jean-Louis A. Parmasad, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 500 µL 20 mg/mL human insulin (Wisent Bioproducts, 511-016-CM), 2.5 mL 1M HEPES (Thermo Fisher Scientific ...
-
Recombinant Antigen
Cat# REC31648-500,
500µg USD $1780.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Huan Ma, et al.,
bioRxiv - Immunology 2021
Quote:
... The expression vectors were transiently transfected to human HEK293F cells with polyethylenimine (Polyscience). Three days later ...
-
No products found
because this supplier's products are not listed.
Yu-Yi Kuo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The supernatants were collected and the protein concentration was quantified by the Bradford protein assay (BioShop Canada Inc., Burlington, Ontario, Canada). Protein samples were stored at −80°C for subsequent western blotting assessments.
-
No products found
because this supplier's products are not listed.
Tomoyuki Ohno, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 201B7 human iPS (RIKEN BRC, HPS0063) cells were maintained in StemFit AK02N medium (ReproCELL) in dishes coated with iMatrix-511 (Nippi) ...
-
No products found
because this supplier's products are not listed.
Reza Nouri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... LwaCas13a proteins were purchased from MCLAB (cat# CAS13a-100). Cas13a and crRNA were mixed in 1×PBS to form the non-activated Cas13a/crRNA at room temperature for 20 min and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Arthur Forer, Shotaro Otsuka,
bioRxiv - Cell Biology 2023
Quote:
Gold beads (15 nm) conjugated with Protein A (Cytodiagnostics, Burlington, Ontario, Canada) were absorbed on both sides of the sections as fiducial markers for tomography reconstruction ...
-
No products found
because this supplier's products are not listed.
Bryan D. Ryder, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein solution was loaded into 3.5kDa cutoff Biotech CE Dialysis Tubing (Spectrum Labs) and dialyzed overnight at 4°C in 1xPBS to restore native folding ...
-
No products found
because this supplier's products are not listed.
Jie Hu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Total protein was extracted from cells using radio immunoprecipitation assay Lysis Buffer (CoWin Biosciences, Beijing, China) containing 1 mM phenylmethylsulfonyl fluoride (Beyotime ...
-
No products found
because this supplier's products are not listed.
Wyatt G. Paltzer, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Aniline Blue Stain Kit” (Newcomer Supply, #9179B) following the kit protocol ...
-
No products found
because this supplier's products are not listed.
Xiaoquan Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and concentrated using ViraTrap lentivirus purification kit (Biomiga). NIH3T3 or RWPE-1 cells or PC3 or LNCaP at 90% confluence were infected with Lenti-FOXP2 ...
-
No products found
because this supplier's products are not listed.
Matthew Patrick, et al.,
bioRxiv - Bioengineering 2023
Quote:
... or a Picro-Sirius Red staining kit (StatLab), following the respective manufacturer’s instructions or immunohistochemistry (IHC ...