-
No products found
because this supplier's products are not listed.
David V.C. Brito, et al.,
bioRxiv - Neuroscience 2020
Quote:
... we used adult male C57BL/6N mice that were 8 weeks old at the time of surgery [(MeCP2-shRNA (n=8) or Control-shRNA (n=8)] (Charles River, Sulzfeld, Germany). The mice were group-housed on a 12h light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Savroop Bhamra, et al.,
bioRxiv - Molecular Biology 2022
Quote:
pRetrosuper shRNA and pLNCX2 constructs were packaged as ecotropic retroviruses in Phoenix ecotropic cells (ATCC, LGC Standards, Middlesex, UK) and used to stably transduce PK1 and CAD5 cells and derivatives thereof ...
-
No products found
because this supplier's products are not listed.
Yash Agarwal, et al.,
bioRxiv - Immunology 2020
Quote:
... Paraffin embedded fixed sections were stained via hematoxylin and eosin or with indicated human antibodies 24 (anti-human CD45-Biocare Medical Cat. No. CME PM016AA; anti-human CD3-Biocare Medical Cat ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Benjamin H. Weinberg, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... plasmid DNA was isolated using mini plasmid preparation (Epoch Life Science). Analytical digests with MluI/BspEI were performed and run on gel electrophoresis to assay if a correct product was made ...
-
No products found
because this supplier's products are not listed.
Indira Wu, Hee Shin Kim, Tuval Ben-Yehezkel,
bioRxiv - Genomics 2019
Quote:
... while human liver total RNA and human blood total RNA were purchased from Zyagen. LoopSeq Transcriptome kit was obtained from Loop Genomics ...
-
No products found
because this supplier's products are not listed.
Marta Calvet-Mirabent, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit anti-human CXCR5 (GeneTex), rat anti-human CD8 (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Joshua G. Pemberton, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Angiotensin II (Human octapeptide; Bachem) was first dissolved in ethanol at 1mM before being prepared as 100 μM aliquots for storage by dilution with ddH2O water ...
-
No products found
because this supplier's products are not listed.
Vojtech Zila, et al.,
bioRxiv - Microbiology 2020
Quote:
... SupT1-R5 cells with AAV (expressing CPSF6 shRNA or non-silencing control shRNA) were distributed at 72 h post-transduction into 96-well plates (1 × 105 cells/well; U-bottom; Greiner Bio-One) and infected with wild-type HIV-1 (1 μUnits of RT/cell) ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Aum R. Patel, et al.,
bioRxiv - Microbiology 2021
Quote:
Normal Adult Human Dermal Fibroblasts and Normal Human Skeletal Muscle Satellite Cells (SkMc) (Lifeline Cell Technologies, USA) were cultured using FibroLife S2 Medium and StemLife SK Medium ...
-
No products found
because this supplier's products are not listed.
Brandon Cieniewicz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... the lentiviral plasmid was combined with three packaging plasmids encoding VSV-G (Aldevron, Cat# 5037-5), gag/pol (Aldevron ...
-
No products found
because this supplier's products are not listed.
Katharina Hoette, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Isolation of organoids from the embedding matrix (human hepatic organoids: Matrigel, Corning; human pancreatic organoids: Cultrex BME2, Amsbio) for fixation and whole-mount staining was performed with slight modifications of protocols published by Broutier et al ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Christin Naumann, et al.,
bioRxiv - Plant Biology 2021
Quote:
... All reagents except human ceruloplasmin (Athens Research) were purchased from Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joelle P. Straehla, et al.,
bioRxiv - Bioengineering 2021
Quote:
Human iPS-ECs (Fujifilm Cellular Dynamics, 11713), human brain PCs and ACs (ScienCell) ...
-
No products found
because this supplier's products are not listed.
Babek Alibayov, et al.,
bioRxiv - Microbiology 2022
Quote:
... Human serum was purchased from MP Biomedicals.
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Maciej Kliszczak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-human FAM111B (HPA038637, Atlas Antibodies) at 1:1000 (IB and IF) ...
-
No products found
because this supplier's products are not listed.
Marco Di Gioia, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human AKT1 (BPS Bioscience, Cat# 40003), AKT2 (BPS Bioscience ...
-
No products found
because this supplier's products are not listed.
Fred E. Fregoso, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and to subclone construct Arpin_CA (residues 194-226). The gene encoding human N-WASP/human Arpin hybrid construct Hybrid_WH2 (Fig. 4a) was synthesized (Biomatik). Other N-WASP/Arpin hybrid constructs (Fig ...
-
No products found
because this supplier's products are not listed.
Wei-Li Ling, Samuel Ken-En Gan,
bioRxiv - Immunology 2022
Quote:
KD measurements of Fc-tagged Human FcμR (Cat: 13556-H02H, SinoBiological) immobilised on Anti-Human IgG Fc (AHC) (Cat: 18-5060, Sartorius) biosensors were performed on the Octet Red96® system with the loading threshold set at 1.0 nm and utilizing the recombinant Pertuzumab and Trastuzumab IgM VH whole antibodies variants in five serial diluted concentrations (12.5 to 200nM ...
-
No products found
because this supplier's products are not listed.
Jianfang Li, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Human C-peptide levels in isolated plasma were quantified using the STELLUX Chemi Human C-peptide ELISA kit (ALPCO Diagnostics) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Juanita C. Limas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Plasmids were validated via sequencing (Eton Biosciences) for the desired insert using appropriate primers.
-
No products found
because this supplier's products are not listed.
Yusuke Kishi, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or plasmid solution using a microloader (Eppendorf) and attached to a FemtoJet (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Michael M. Lutz, et al.,
bioRxiv - Microbiology 2019
Quote:
... Human Pancreatic Ductal Epithelial (HPDE) cells (Kerafast H6c7) were maintained in keratinocyte SFM (serum-free medium ...
-
No products found
because this supplier's products are not listed.
Alessandro Manenti, et al.,
bioRxiv - Immunology 2020
Quote:
... The human monoclonal antibody IgG1-CR3022 (Absolute Antibody) and the human monoclonal antibody IgG1 SAD-S35 (Acrobiosystem ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Deborah. L. W. Chong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or human CD61 (clone 2f2, Leica Biosystems, Wetzlar, Germany). Sections were scanned on a Nanozoomer Digital Slide Scanner and analysed using NDP.view software (both from Hamamatsu Corporation ...
-
No products found
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
No products found
because this supplier's products are not listed.
Abir Mukherjee, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 million stable SKOV3ip1 cells (transduced with either control shRNA or shRNA targeting HIF1α) were injected into female athymic nude mice (Envigo), and tumors were allowed to establish for 4 weeks ...
-
No products found
because this supplier's products are not listed.
Satadeepa Kal, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Recombinant Human Wnt 3a (BioVision) was administered at 150 ng/ml for 24 hours ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Sunghan Jung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-Human sAPPbeta (Tecan (IBL), JP18957) ...
-
No products found
because this supplier's products are not listed.
Pedro Justicia-Lirio, et al.,
bioRxiv - Immunology 2024
Quote:
... plasmid pCMVDR8.91 and plasmid pMD.G as described in (22) using polyethylenimine (PEI) (Alfa Aesar). Viral supernatants were collected 48 and 72h post transfection and concentrated 100x by ultracentrifugation (90000g ...
-
No products found
because this supplier's products are not listed.
Erica R. Vander Mause, et al.,
bioRxiv - Bioengineering 2022
Quote:
... containing the pBirAcm plasmid (Avidity).
-
No products found
because this supplier's products are not listed.
S Momsen Reincke, et al.,
bioRxiv - Immunology 2021
Quote:
... Human mAbs were applied and detected using HRP-conjugated anti-human IgG (Dianova, 709-035-149) and the HRP substrate 1-step Ultra TMB (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Sergey Matveevsky, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... human anti-centromere antibodies CREST (Fitzgerald Industries International ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human DARPP-32 isoforms purified from NSCLC cells were incubated with kinase-activated human IKKα protein (SignalChem) for in vitro kinase assays by following previously described methods70 ...
-
No products found
because this supplier's products are not listed.
Paola Monteiro de Oliveira, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The plasmids were recovered using the Favorprep™ Plasmid DNA Extraction Mini Kit (Favorgen, Wien, Austria) and the assemblies were confirmed by PCR and sequencing.
-
No products found
because this supplier's products are not listed.
Vignesh Kasinath, et al.,
bioRxiv - Biophysics 2020
Quote:
... All human nucleosomes were purchased from Epicypher with the 5’ biotinylated 187 bp DNA sequence containing the 601 positioning sequence ...
-
No products found
because this supplier's products are not listed.
Diego Gilioli, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10% Human Serum (cat#ECS0219D from Euroclone) and IL-2 (cat#F027131010 from Novartis ...
-
No products found
because this supplier's products are not listed.
Yuliya Kurlishchuk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 20 ng/ml human EGF (Biomol). All cells were kept at 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
... containing 100 U/mL recombinant human IL-2 (rhIL-2, Novartis Oncology) and 0.5 ng/mL recombinant human IL-15 (rhIL-15, CellGenix). For CAR lentiviral transduction ...
-
No products found
Philipe R. F. Mendonça, et al.,
bioRxiv - Neuroscience 2021
Quote:
... At 5 days in vitro (5 DIV) neurons were transfected with pAAV.hSynap.SF-iGluSnFR.A184V plasmid 14 (addgene Plasmid #106174) using Neuromag reagent (KC30800; OZ Biosciences). The transfection resulted in sparse expression of the iGluSnFR probe in a small subpopulation of neurons (~3%) ...
-
No products found
because this supplier's products are not listed.
R. Bordeira-Carriço, et al.,
bioRxiv - Genomics 2020
Quote:
... Plasmids were extracted with NZYMiniprep kit (NZYTech) and confirmed by Sanger sequencing ...
-
No products found
because this supplier's products are not listed.
Milene Mantovani, John Campbell McNamara,
bioRxiv - Physiology 2020
Quote:
The plasmids were sequenced (Genetic Analyzer, ABI PRISM Model 3100 ...
-
No products found
because this supplier's products are not listed.
Théo Juncker, et al.,
bioRxiv - Immunology 2023
Quote:
... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Pooled human plasma was acquired from Zen-Bio Inc ...
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-MERS-S2 IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S2 subunit spike protein ...