-
No products found
because this supplier's products are not listed.
Victoria L. Messerschmidt, et al.,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with Vasculife VEGF growth factor kit (LS-1020, Lifeline Cell Technologies) up to passage 7 in a 5% CO2 environment ...
-
No products found
because this supplier's products are not listed.
Robert Fresch, et al.,
bioRxiv - Genetics 2022
Quote:
Human Placenta Microvascular Endothelial Cells (HPMVECs) were cultured in T75 flasks pre-treated with attachment factor (Cell Applications Inc.) at 37°C ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Sylvie J Lavictoire, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 2μl of 10 μM electroporation enhancer (Alt-R Cas9 Electroporation Enhancer, IDT DNA Technologies). To prepare the Neon Transfection System for electroporation ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Yuling Han, et al.,
bioRxiv - Microbiology 2020
Quote:
... in the presence of SFD containing either a combination of five factors (3 μM CHIR99021, 10 ng/ml human FGF10, 10 ng/ml human FGF7, 10 ng/ml human BMP-4, and 50 nM ATRA), or three factors (3 μM CHIR99021 ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Alison K Francois, et al.,
bioRxiv - Microbiology 2023
Quote:
... and cultured with 5 ng/ml human fibroblast growth factor (FGF, Gemini Bio-Products 300-113P) throughout clonal selection ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Lindsey A Allan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... human ACA (90C-CS1058 from Fitzgerald, 1:2000), rabbit Cyclin B1 (#12231S from Cell signalling technology ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Robert W Hunter, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The binding sites of HRP-conjugated secondary antibodies were detected with Red Opal (1:100, AKOYA Biosciences) and a DAPI counterstain was applied (1:1000) ...
-
No products found
because this supplier's products are not listed.
Oswaldo Tostado-Islas, et al.,
bioRxiv - Microbiology 2020
Quote:
... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Platelet-activating Factor was from Avanti polar Lipids, Alabaster ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Luca Carta, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Binding was measured between EDA-GTP-Cy5 (Jena Bioscience GmbH, Jena, Germany) and His-tagged labeled proteins in Buffer I ...
-
No products found
because this supplier's products are not listed.
Nadja I. Lorenz, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml human recombinant basic fibroblast growth factor (bFGF) (ReliaTech, Wolfenbüttel, Germany).
-
No products found
because this supplier's products are not listed.
Federica Fabro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... human basic fibroblast growth factor (FGF; 20 ng/mL) (both from Tebu-Bio), and heparin (5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the experimental AAV containing a smaller iteration of this enhancer (WPRE3) due to space limitations which retains a high degree of enhancer activity6.Both viruses were purchased from Vector Biolabs and were provided in PBS solution with 5% glycerol at a titre of ∼1013 genome copies/ml.
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Vilma Väänänen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Equal amounts of solutions A (Enhancer) and B (Activator) of the kit (GoldEnhance for LM, 2112-28ML, Nanoprobes) were mixed and left to incubate for 10 minutes before addition of solutions C (Initiator) ...
-
No products found
because this supplier's products are not listed.
Xiuqing Han, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... tumor necrosis factor α (TNF-α) and TATA box binding protein (TBP) were determined by real☐time PCR (ABI 7900 Prism, Applied Biosystems, US). Sequences used to amplify a fragment of IL-6 were FP ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and recombinant human FN III 12,13 N-GST (“HBDII”, which is derived from heparin-binding domain II of FN; #EUR120, Kerafast). Sheared DNA molecules were then added dropwise with continuous stirring at 400∼500 rpm with the final concentration of 10 µg/ml ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Angela M. Bosco-Lauth, et al.,
bioRxiv - Microbiology 2020
Quote:
... Positive control antibodies to the receptor-binding domain (RBD) and full-length spike protein were human MAb CR3022 antibody (Absolute Antibody, Oxford UK) and human IgG whole molecule (Jackson Immuno Research ...
-
No products found
because this supplier's products are not listed.
Raghu Ramesh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... RT4 Schwann cells were transfected with those enhancers and pRL-TK using TransIT-X2 (Mirus#MIR6004) and harvested for dual-luciferase assay 48hr post-transfection (n=3 per group) ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Gabriella Fioravanti, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50 ng/mL nerve growth factor (Envigo NGF 2.5S), or 5nM ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Gabriele Flossmann, et al.,
bioRxiv - Genomics 2020
Quote:
... Library preparation followed ultrasonic fragmentation (Covaris: 50 s, 5% duty factor) using the Illumina TruSeq DNA PCR-Free Sample Preparation Kit with an insert size of 350 bp ...
-
No products found
because this supplier's products are not listed.
Chad W. Hicks, et al.,
bioRxiv - Biophysics 2024
Quote:
Nucleosomes for dCypher™ Luminex nucleosome binding assays (unmodified (EpiCypher 16-0006); acidic patch mutant H2A(E61A ...
-
No products found
because this supplier's products are not listed.
Rendy Hosea, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Human genome DNA extracted from HCT116 cells using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China) was used as template for amplifying the promoter regions ...
-
A component of the Papain Dissociation System, for use in the tissue dissociation method of...
Cat# LK003176,
1 vi, $29.00
Ask
Marco Bauzá-Thorbrügge, et al.,
bioRxiv - Physiology 2022
Quote:
Human adipocytes were isolated from adipose tissue samples by collagenase (type 1, Worthington, NJ, USA) as described previously [24] ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
L. Perrin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... SIDs were made by binding poly-dimethyl-siloxane (PDMS) disks to the glass-bottom dishes (MatTek Corporation). Each PDMS disk measures 17.5 mm in diameter and contains three wells ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Claire M Storey, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... Antibody binding capacity of cells was assessed using 1 µg/mL DUNP19 and anti-human IgG Simply Cellular bead standards (Bangs Laboratories, #816). Quantity of LRRC15 surface antigens available for DUNP19 binding was normalized to cell surface area (determined experimentally by confocal microscopy) ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Ana I. Arroba, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1) (1:500, 019-19741, WAKO, FUJIFIL Cellular Dynamics, Madison, WI, USA) or rabbit anti-huntingtin D7F7 (1:300 ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
David N. Tippett, et al.,
bioRxiv - Biophysics 2023
Quote:
... prior to binding to Streptactin Superflow high-capacity resin (IBA Lifesciences) equilibrated in wash buffer (25 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Fabrizia Zevolini, et al.,
bioRxiv - Immunology 2023
Quote:
... CTLs at 5 days of differentiation were transiently transfected using the Human T cell nucleofector kit and the program T-023 of the Nucleofector II system (Amaxa Biosystems, Euroclone, Milan, Italy) for activated cells with 1 μg/106 cells of pEGFP-EB1 plasmid ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...