-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2020
Quote:
... The double-labeled cells were coated with clade A gp120 (BL035.W6M.Env.C1, (Wu et al., 2006)) or clade C gp41 ectodomain (C.ZA.1197MB, Immune Technology Corp, New York, NY) (Rousseau et al. ...
-
No products found
because this supplier's products are not listed.
Eliza D. Hompe, et al.,
bioRxiv - Immunology 2019
Quote:
... HIV Env-specific IgG was then detected with phycoerythrin (PE)-conjugated mouse anti-human IgG (Southern Biotech, Birmingham, AL) at 2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Nathaniel Talledge, et al.,
bioRxiv - Microbiology 2023
Quote:
... band in culture supernatants using anti-HIV-1 p24 primary antibodies (NIH HIV Reagent Program, Manassas, VA – Mouse anti p24: ARP-6521) and goat anti mouse IRDye® 800CW (LI-COR Biosciences, NE). Capsid protein levels were assessed by SDS-PAGE followed by immunoblotting with an anti-HIV-1 CA (p24 ...
-
No products found
because this supplier's products are not listed.
Caroline Bull, Graham Mayrhofer, Michael Fenech,
bioRxiv - Cancer Biology 2019
Quote:
Human WIL2-NS (B lymphoblastoid) cells (American Type Culture Collection (ATCC); CRL-8155 ...
-
No products found
because this supplier's products are not listed.
Christian Heuss, et al.,
bioRxiv - Microbiology 2022
Quote:
... −20M and GLT1cc infected human liver chimeric mice using the NucleoSpin Virus kit (Macherey-Nagel) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
A. Chansard, et al.,
bioRxiv - Immunology 2020
Quote:
... the cells were incubated with a monoclonal anti-human NF-B p65 antibody (27F9.G4, 1/2000, Rockland) diluted in the blocking solution (PBS-milk 5% ...
-
No products found
because this supplier's products are not listed.
M. Zeeshan Chaudhry, et al.,
bioRxiv - Microbiology 2021
Quote:
... the virus suspension was mixed 1:1 with peqGOLD TriFast (VWR). Following ...
-
No products found
because this supplier's products are not listed.
Ankita Leekha, et al.,
bioRxiv - Immunology 2022
Quote:
... and 20µg of nucleocapsid protein-B.1.17 (Acrobiosystems, #NUN-C52H8) were mixed with 20µg of NanoSTING ...
-
No products found
because this supplier's products are not listed.
Sonali Jindal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... human COX2 protein (Cayman Chemical, 60122, 4ng), and 25μg cell line lysates in RIPA buffer were separated by WES automated gel electrophoresis System (Protein Simple ...
-
No products found
because this supplier's products are not listed.
Daniel S. Hassell, et al.,
bioRxiv - Genetics 2021
Quote:
... Hygromycin B (#H-270-1, Gold Biotechnology) was added to YPD at 200 μg/mL ...
-
No products found
because this supplier's products are not listed.
Sofiane Hamidi, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... β-Dystroglycan (1:100; Leica #NCL-b-DG), aPKCς clone C-20 (1:400 ...
-
No products found
because this supplier's products are not listed.
William N. Feist, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Standard curves were created using purified versions of each HIV inhibiting antibody or purified human IgG/kappa from normal serum (Bethyl, Montgomery, TX, USA, cat.: P80-111). Results were analyzed using GraphPad Prism v10 software to calculate a standard curve using a 4-parameter or 5-parameter sigmoidal algorithm ...
-
No products found
because this supplier's products are not listed.
Paola Munoz-Tello, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... cytosporone B (Tocris), and TMPA (EMD Millipore) ...
-
No products found
because this supplier's products are not listed.
Ana Martínez-Riaño, et al.,
bioRxiv - Immunology 2020
Quote:
... purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1:1 bead:Bcell ratio ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Oriol Llora-Batlle, et al.,
bioRxiv - Genomics 2024
Quote:
... Female severe combined immunodeficiency disease (SCID) mice were purchased from Envigo UK ...
-
No products found
because this supplier's products are not listed.
Sandra Schifferdecker, et al.,
bioRxiv - Microbiology 2022
Quote:
... 20,000 cells were infected with HIV-1* or HIV-1*CA14SiR in a 96-well v-bottom microplate (Greiner Bio-one, cat. #650161) in a volume of 40 µl RPMI and transferred at 22 h p.i ...
-
No products found
because this supplier's products are not listed.
Jun-yi Zhu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... raised against human polyubiquitin-B and polyubiquitin-C (1:100) (BML-PW8810, Enzo Life Sciences); Rabbit polyclonal antibody against protein disulfide isomerase (1:100 ...
-
No products found
because this supplier's products are not listed.
Bruno A. Duso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human anti-centromere protein (Antibodies Incorporated, 15-234; 1:1000), rabbit anti-phospho-histone H3(Ser10 ...
-
No products found
because this supplier's products are not listed.
Silvio Schmidt, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the S100 calcium-binding protein B (S100B; rabbit, Synaptic system), and BrdU (mice ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or along with the human recombinant proteins: WASP-VCA domain protein (Cat# VCG03, Cytoskeleton) or ERK3 protein (M31-34G ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Josie L Ferreira, et al.,
bioRxiv - Microbiology 2022
Quote:
... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
No products found
because this supplier's products are not listed.
Rachid Essalmani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-p24 (MBS Hybridoma line 31-90-25) or anti-actin (MP Biomedicals, SKU 08691001), respectively.
-
No products found
because this supplier's products are not listed.
Pin-Ji Lei, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... we inoculated 1×105 PFU UV-inactivated PR8 influenza virus + 2μg Anti-CD40 (BioXCell, Cat: BE0016-2) + 2μg poly I:C (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Shotaro Torii, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3 µL of the purified CVB5 mutant virus sample at 4.5 mg mL-1 concentration was loaded onto Quantifoil R 1.2/1.3 grids (EMS), that were previously glow-discharged for 30 s in a GloCube Plus device (Quorum Technologies) ...
-
No products found
because this supplier's products are not listed.
Jiang-Hui Wang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The collected virus was filtered (0.45 μm filter, Sartorius) and concentrated using PEG-it overnight at 4°C (SBI Integrated Sciences ...
-
No products found
because this supplier's products are not listed.
Roberto Vincis, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 100-150 nl of virus was injected at 1 nl/s with a microinjection syringe pump (UMP3T-1, World Precision Instruments, Sarasota, FL). Following injection ...
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-SARS-CoV-2 Virus Spike 1 [S1] IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S1 subunit spike protein ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mayte Vallejo-Cremades, et al.,
bioRxiv - Immunology 2023
Quote:
... for lymphocytes B, rabbit anti mouse CD206 (dilution, 1:200; Bio Orbyt, orb180464) and rabbit anti human p67 (dilution 1:1000, Bioss antibodies). As secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Siti Naqiah Amrun, et al.,
bioRxiv - Immunology 2019
Quote:
... virus inoculum was removed and replaced with IMDM with 10% human serum (HS; Innovative Research Inc). Cells were incubated at 37°C and harvested at time-points 0 ...
-
No products found
because this supplier's products are not listed.
Xiaoning Yang, et al.,
bioRxiv - Immunology 2023
Quote:
Recombinant human PD-1 protein was biotinylated and loaded using SA sensor (Pall Corporation). Six concentrations of Finotonlimab and Nivolumab were added for real-time association and dissociation analysis using Octet system ...
-
No products found
because this supplier's products are not listed.
Young Bong Choi, et al.,
bioRxiv - Immunology 2021
Quote:
Purified recombinant human TAX1BP1 protein (catalog # P01; Abnova) was incubated with purified GST-tagged IKKi (catalog # PV4875 ...
-
No products found
because this supplier's products are not listed.
Tao Ni, et al.,
bioRxiv - Microbiology 2023
Quote:
... Proteins were probed with the primary antibody anti-CsoS1A/B/C (Agrisera, Cat No. AS14 2760, dilution 1: 5,000), anti-CsoS2-N (1:10,000 dilution ...
-
No products found
because this supplier's products are not listed.
Iart Luca Shytaj, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
No products found
because this supplier's products are not listed.
Emiel Vanhulle, et al.,
bioRxiv - Microbiology 2022
Quote:
... and Omicron (COV2 spike protein S recombinant B.1.1529 Omicron, cat n° MBS553745, Mybiosource) SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Alexander W. Justin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Green fluorescent protein (GFP) and Red Fluorescent Protein (RFP) human umbilical vein endothelial cells (HUVECs, Promocell), normal human lung fibroblasts (NHLFs ...
-
No products found
because this supplier's products are not listed.
Andrew B Janowski, et al.,
bioRxiv - Microbiology 2022
Quote:
... the virus RNA was isolated from the virus stocks using Direct-zol RNA MicroPrep (Zymo research) and used for RT-PCR and Sanger sequencing of the entire virus genome.
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Jingyi Guo Fuglstad, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Fluorescent signal from the virus was amplified by immunostaining against Red Fluorescent Protein (RFP) (catalog no.5F8, Chromotek GmbH, Germany), followed by secondary antibody-staining with Alexa 546-tagged Goat Anti-rat IgG (catalog no ...
-
No products found
because this supplier's products are not listed.
Brian R. Isett, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Virus (Striatum: 0.5-1 μl, GPe: 150 nL) was injected with a Nanoject (Drummond Scientific) through a pulled glass pipet (tip diameter ∼30 μm ...
-
No products found
because this supplier's products are not listed.
Pavitra Ramdas, et al.,
bioRxiv - Microbiology 2020
Quote:
... HIV-1 Infectivity was quantified by scoring the GFP positive cells using Spectra max MiniMax™ 300 imaging Cytometer (Molecular devices, USA). Foamy Virus infectivity was examined by the number of GFP positive cells indicating the population transduced by Foamy virus ...
-
No products found
because this supplier's products are not listed.
Jason Neidleman, et al.,
bioRxiv - Immunology 2020
Quote:
... or Influenza Virus Control Peptide Pool (Anaspec). As a positive control for cytokine detection ...
-
No products found
because this supplier's products are not listed.
Ying Wang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... in a 1:1 mixture of Bronchial Epithelial Cell Medium-basal (BEpiCM-b; ScienCell, Sanbio) and Dulbecco’s modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Oliver J. Gough, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Negative Control Primer Set 1 (Active Motif, #71001), Human Negative Control Primer Set 3 (Active Motif ...
-
No products found
because this supplier's products are not listed.
Dora Buzas, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1 mol% DGS-NTA(Ni2+) and 1 mol% Rhodamine B-PE (all lipids obtained from Avanti Polar Lipids).
-
No products found
because this supplier's products are not listed.
Jan Steinkühler, et al.,
bioRxiv - Biophysics 2020
Quote:
... Human Transferrin – CF488A (Biotium) at 130 nM ...