-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Saskia Meyer, et al.,
bioRxiv - Immunology 2021
Quote:
... GenBank: MN908947.3) under the control of a tetracycline-inducible promoter (Retro-X™ Tet-One™ Inducible Expression System, Takarabio) with a puromycin selection marker ...
-
No products found
because this supplier's products are not listed.
Seth J. Zost, et al.,
bioRxiv - Immunology 2021
Quote:
... The plates were washed and 25 μL of ELISA buffer containing a 1:4,000 dilution of anti-human IgG alkaline phosphatase conjugate (Meridian Life Science, W99008A) was added ...
-
No products found
because this supplier's products are not listed.
Drake A. Russell, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2,3-dichloro-alpha-methylbenzylamine was sourced from Enamine (Monmouth Jct., NJ). Reagents and materials for E ...
-
No products found
because this supplier's products are not listed.
Nathan Hodson, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and visualized using a Fluorochem E Imaging system (Protein Simple; Alpha Innotech, Santa Clara, CA). Bands were quantified using Protein Simple AlphaView SA software and normalized to Ponceau S and a gel control (identical generic sample run on every gel).
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Christophe Chapard, et al.,
bioRxiv - Genetics 2023
Quote:
... Yeast cells were synchronized in G1 by adding α-factor (Proteogenix, WY-13) in the media every 30 min during 2h30 (1 μg/mL final) ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... then next the Transcription factor (TF) Activation Profiling Plate Array II (FA-1002, Signosis, CA) was used to monitor 96 TFs simultaneously ...
-
FITC conjugated recombinant human KIT (P10721-1) (Val50-Gln190), fused with a polyhistidine tag...
Cat# KIT-396HF,
50ug , USD $1298
Ask
Noah R. Johnson, et al.,
bioRxiv - Neuroscience 2021
Quote:
... recombinant human apoA-I (Creative Biomart), human plasma-derived apoE (Sigma) ...
-
No products found
because this supplier's products are not listed.
Joseph H. Chapman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli cells or homemade DH5-alpha competent cells and plated onto LB agar plates with 30 µg/mL kanamycin (Teknova L1024). After a 37°C overnight incubation ...
-
No products found
because this supplier's products are not listed.
Mouhamed Alsaqati, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ESGRO leukemia inhibitory factor (LIF) (Chemicon) at 37°C in an incubator (Galaxy 170R, New Brunswick, USA). The mECs media were changed daily and cells were passaged every other day using TrypLE (Gibco ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Qinghui Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... Naïve CD3 human T cells were purchased from HemaCare (Lot #21068415). N/TERT-1 cells were a gift from the Rheinwald Lab (Dickson et al. ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Bhuvic Patel, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were incubated in a O2 Control InVitro Glove Box Hypoxia Chamber (Coy Lab Products) instead of adding DFX and were kept in the chamber until one day post radiation except for the short period of time necessary to administer radiation ...
-
No products found
because this supplier's products are not listed.
Marc Sunden, et al.,
bioRxiv - Biochemistry 2023
Quote:
A peptide (NH2-KKKYPGGSTPVSSANMM-COOH) containing an O-GlcNAcylation site of human Casein kinase II subunit alpha (underlined sequence) was custom synthesized by Nordic BioSite. A mixture of 6 mM glutaraldehyde ...
-
No products found
because this supplier's products are not listed.
Zane Kliesmete, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Primary antibodies (chicken alpha-GFP, Aves Labs: GFP-1010 and rabbit alpha-Ki67 ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Judith A. Sharp, Wei Wang, Michael D. Blower,
bioRxiv - Cell Biology 2019
Quote:
... Tet-inducible SAF-A-GFP alleles were detected using alpaca α-GFP (Bulldog Bio, GBA488).
-
No products found
because this supplier's products are not listed.
Carlo Dal Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-alpha-tubulin (α-tubulin) (EXBIO Praha, Czech Republic) diluted 1:500 ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Gebrehaweria Kidane Reda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... in PCRmax Alpha Thermal Cycler (Cole-Parmer Ltd., Vernon Hills, IL, USA) (see supplementary material for more detailed protocol).
-
No products found
because this supplier's products are not listed.
Syed Moiz Ahmed, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Endogenous TOP1cc were detected by Human Topoisomerase ICE kit (Topogen, TG1020-0) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Sarah M. Mohr, et al.,
bioRxiv - Physiology 2024
Quote:
... T3 concentration was measured by ELISA (Leinco Technologies, T181). Dried product was resolubilized in the zero-standard and the kit run according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Brittney S. Harrington, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Mice injected with OV90 cells containing the DOX-inducible shRNA were fed doxycycline chow (200mg/kg, S3888, Bio-Serv, Flemington, NJ) for the duration of the study ...
-
This kit is a sandwich ELISA assay for the quantitative measurement of ACAT1 in human serum,...
Cat# KITE1066,
Inquiry
Ask
Ilaria Frasson, et al.,
bioRxiv - Microbiology 2023
Quote:
... We conducted genome-wide negative selection (dropout) screens in Cas9-Calu-3 cells by using the human GeCKO v2 library (Creative Biogene, cat. CCLV0001) that targets 18823 genes with 6 gRNAs/gene as well as 1000 non-targeting gRNAs ...
-
This product is an ELISA kit for the in vitro determination of Human TNF-a in the samples of...
Cat# CTK-912,
1.0 case, Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Alexandra Grubman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were transfected for 48 h with dox-inducible GFP-tagged Gateway-generated Piggybac expression constructs with inserted cDNA encoding human HIF1A and/or ELF3 open reading frames using Glial Mag transfection kit (Oz Biosciences, #GL00500) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nazila V. Jafari, Jennifer L. Rohn,
bioRxiv - Microbiology 2022
Quote:
HBLAK human bladder progenitor cells (CELLnTEC, Switzerland) were grown according to the CELLnTEC protocol ...
-
No products found
because this supplier's products are not listed.
Aly Elezaby, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Huu Tuan Nguyen, et al.,
bioRxiv - Bioengineering 2023
Quote:
Human umbilical vein endothelial cells (ECs, Angio-Proteomie, MA, USA) were cultured in Vasculife (LifeLine Cell Technology ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...