-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Sienna S. Drake, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Voltages were set up according to optimal PMT sensitive using the peak 2 (Spherotech) voltration technique ...
-
No products found
because this supplier's products are not listed.
Laura M. Sipe, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and mammary fat pad tissue using a kit specific for lipid rich tissue (Norgen Biotek, Ontario, Canada). The integrity of RNA was assessed using Agilent Bioanalyzer and samples with RIN >8.0 were used ...
-
No products found
because this supplier's products are not listed.
Lisa Koshko, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or alpha MSH (rabbit, Phoenix Pharmaceuticals INC, 1:1000) primary antibody ...
-
No products found
because this supplier's products are not listed.
Muttarin Lothong, et al.,
bioRxiv - Microbiology 2022
Quote:
Rabbit polyclonal antibody (pAb) against PRRSV envelop glycoprotein GP5 (Biorbyt Ltd., Cambridge, UK; dilution 1:100) was used to detect PRRSV protein ...
-
No products found
because this supplier's products are not listed.
Vidyanand Anaparti, et al.,
bioRxiv - Physiology 2019
Quote:
... C-reactive protein (CRP) levels were measured using a human high-sensitivity CRP (hs-CRP) ELISA kit (Biomatik, Canada) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maria Zimmermann-Kogadeeva, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and lysed in a bead beater high for 4 min (2 min / kept on ice 1 min / 2 min) (BioSpec Products). Cellular debris was removed by centrifugation (8,000 × g ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and purified human C1q protein (2 µg/mL, Complement Technology) was suspended in GVB++ Buffer (Complement Technology ...
-
No products found
because this supplier's products are not listed.
Kai Lu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were trained on an elevated T-maze 1 covered with Alpha-Dri (Shepherd Specialty Papers) bedding material ...
-
No products found
because this supplier's products are not listed.
Veronica Gonzalez, et al.,
bioRxiv - Genomics 2021
Quote:
... that contained alpha-thio-ddNTPs (Trilink Bio Technologies) at equal ratios at a concentration of 1200 μM in the final amplification reaction ...
-
No products found
because this supplier's products are not listed.
Ashley S. Denney, et al.,
bioRxiv - Genetics 2021
Quote:
... The TH5 strain was propagated on rich or synthetic medium with 100 µg/mL dTMP (TCI America #TCT0845), or on minimal medium containing essential amino acids adenine ...
-
No products found
because this supplier's products are not listed.
Julie G Burel, et al.,
bioRxiv - Immunology 2020
Quote:
... 2 μl of anti-human CD19-PECy7 antibody (clone HIB19, TONBO biosciences), and 3 μl of anti-human TCRab-AF488 antibody (clone IP26 ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Stefan Dannenmaier, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Samples in the presence and absence of 2 mM ATP with 2 mM MgCl2 were loaded in high-sensitivity capillaries (Nanotemper, Munich, Germany) and heated with a 0.3°C/min temperature ramp from 20°C to 70°C with a 2 sec DLS integration time.
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
B. I. M. Wicky, et al.,
bioRxiv - Biophysics 2022
Quote:
... The following sitting drop broad screens were set up at room temperature with three protein:crystallization condition ratios (1:1, 1:2, 2:1) using the mosquito pipetting instrument (sptlabtech): Midas (Molecular Dimensions), Proplex (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Yuan Hong, et al.,
bioRxiv - Biophysics 2023
Quote:
... The tissue force measurements were performed using a custom-made tensile tester with sensitive isometric force transducers (Harvard Apparatus) and stepper motors (Haward Industry ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Yonghui Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were expanded in human SMC growth medium kit (Cell Applications, Inc., 311K-500) under the standard culture condition (37 °C with 5% CO2 in a humid environment ...
-
No products found
because this supplier's products are not listed.
Dedrick Kok Hong Chan, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-human FBXW7 antibody (1:2500, BS-8394R, Bioss, USA), rabbit anti-human phosphor-CJUN antibody (1:2500 ...
-
No products found
because this supplier's products are not listed.
Georgios Kotsaris, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Proliferation medium was then removed and replaced with differentiation medium (high glucose DMEM, 2% horse serum (PAN biotech), 1% P/S) ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and serine 2 (Chromotek, diluted 1:200). After washing with PBS ...
-
No products found
because this supplier's products are not listed.
Laura C. Sommerfeld, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... maps were generated from isolated left atria loaded with the voltage-sensitive dye Di-4-ANEPPS (17.5 μM; Cambridge Bioscience, CA, USA), paced over a range of 120-80 ms cycle length (CL ...
-
No products found
because this supplier's products are not listed.
Wioletta Rut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the supernatant was set for crystallization screening by using commercially available screening kits (PEGRx™ 1 & 2 (Hampton Research) and Morpheus HT-96 (Molecular Dimensions)) ...
-
No products found
because this supplier's products are not listed.
Stephen R. Doyle, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed using the Trimmer-2 cDNA normalisation kit (Evrogen) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bar Manori, et al.,
bioRxiv - Biochemistry 2023
Quote:
A mixture of 2.75:1.25:1 mg of chloroform-dissolved 1-Palmitoyl-2-Oleoyl-sn-Glycero-3-Phosphoethanolamine (POPE): 1-Palmitoyl-2-Oleoyl-sn-Glycero-3-Phosphoglycerol (POPG):cholesterol (Anatrace) were dissolved and mixed in chloroform ...
-
Leucine ((S)-Leucine, Leu) is one of nine essential amino acids in humans which is important for...
Cat# S3753, SKU# S3753-1g,
1g, $970.00
Ask
Rabea Dettmer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 2 µM IWR-1 (Selleck Chemicals, Munich, Germany), 0.5 µM LDN193189 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Yen-Wei Chen, et al.,
bioRxiv - Systems Biology 2021
Quote:
... high fat high sucrose (HFHS) diet (Research Diets-D12266B, New Brunswick, NJ) to induce hepatic steatosis ...
-
No products found
because this supplier's products are not listed.
Valentin Bohl, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2 mM DTT) inside a 1 ml Polystyrene Cuvette (Sarstedt). MDH activity was quantified by measuring absorption at 340 nm every 10 s for 30 s on a Biochrom Novaspec Plus photometer ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cells were plated on alpha-numeric gridded glass-bottom coverslips (P35G-1.5-14-C-GRID, MatTek, MA, USA) at ∼40-50% confluency and fixed with 2% formaldehyde ...
-
No products found
because this supplier's products are not listed.
Adam J. Widman, et al.,
bioRxiv - Genomics 2022
Quote:
... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
No products found
because this supplier's products are not listed.
Joseph E Kaserman, et al.,
bioRxiv - Cell Biology 2022
Quote:
Secreted total AAT was quantified from iHep supernatants using the human alpha-1-antitrypsin ELISA quantification kit (GenWay Biotech) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
Cat# H2V220-1,
USD $1050.0/mg
Ask
Akihisa Kato, et al.,
bioRxiv - Microbiology 2023
Quote:
... glycoprotein B (gB) (H1817; Virusys), Flag (M2 ...
-
No products found
because this supplier's products are not listed.
AP Bosworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... equipped with a sensitive backscatter detector (Gatan), as well as extended raster scanning capabilities and a control system designed for serial section imaging workflows (ATLAS5 ...
-
RatCol® High Concentration Type I Acid Soluble Rat Tail Collagen contains 100 mg at a...
Cat# IKD119261001,
10 mL, USD $315.0
Ask
Samuel S. Hinman, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were coated with 2 mL of 10 µg mL-1 human type 1 collagen (5007, Advanced Biomatrix) in 1× PBS (46-013-CM ...
-
No products found
because this supplier's products are not listed.
Rachel Yamin, et al.,
bioRxiv - Immunology 2022
Quote:
... Afucosylated human IgG1 was generated in the presence of 0.2 mM 2-deoxy-2-fluoro-l-fucose (2FF) (Carbosynth, MD06089) during transfection of recombinant antibodies42 ...
-
No products found
because this supplier's products are not listed.
Madeleine L. Hart, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TF-1 cells were also supplemented with the 2 ng/ml Human Granulocyte Macrophage-Colony Stimulating Factor (GM-CSF) (Shenandoah Biotechnology, 100-08). Cells were incubated in a humidified incubator at 37°C with 5% CO2.
-
No products found
because this supplier's products are not listed.
Dipti Athavale, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Human low-density lipoprotein cholesterol (hLDLc) and high-density lipoprotein cholesterol (hHDLc) were purchased from Lee Biosolutions (Missouri, USA). Simvastatin (SIM ...
-
No products found
because this supplier's products are not listed.
Caylin G. Winchell, et al.,
bioRxiv - Microbiology 2020
Quote:
... before incubation in alpha-MEM + 10% StasisTM FBS (Gemini Bio-Products) + MitoTrackerTM Red CMXRos (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
No products found
because this supplier's products are not listed.
Fyodor D. Urnov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... one-fifth of each sample was then electrophoresed on a 2% high-resolution blend agarose (Amresco) gel in 1x Tris-acetate-EDTA buffer (40 mM Tris-acetate ...
-
No products found
because this supplier's products are not listed.
Kamyab Javanmardi, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The plasmid expressing the VSV-G (vesicular stomatitis virus glycoprotein) was purchased from Cell Biolabs (pCMV-VSV-G, Part No. RV-110). The lentiviral plasmid used to generate the HEK-293T stable cell lines expressing the human ACE2 gene (GenBank ID NM_021804 ...
-
No products found
because this supplier's products are not listed.
Caroline Atyeo, et al.,
bioRxiv - Immunology 2021
Quote:
... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maximilian Nagel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... slices were incubated (90 min; 5°C) in circulating S2 with the Ca2+-sensitive dye CAL520/AM (4.5 μM; Biomol, Hamburg, Germany) and 0.05 % Pluronic® F-127 (20 % solution in DMSO ...
-
No products found
because this supplier's products are not listed.
Cecilia Webber, et al.,
bioRxiv - Microbiology 2024
Quote:
... The filtered extract was directly injected onto a reversed-phase preparative high-performance liquid chromatography (HPLC) column (Phenomenex Luna C18 (2), 250 × 21.2 mm ...
-
No products found
because this supplier's products are not listed.
Alaullah Sheikh, et al.,
bioRxiv - Microbiology 2022
Quote:
... in vitro grown differentiated polarized monolayers of human ileal enteroid samples as well as mouse intestinal biopsy samples were fixed in 2% paraformaldehyde/2.5% glutaraldehyde (Ted Pella, Inc., Redding, CA) in 100 mM sodium cacodylate buffer ...
-
1 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C1-1.5H-N,
48/case, $219.00
Ask
Siddhartha G. Jena, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.17mm high performance glass-bottom plates (Cellvis). Before plating ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...