-
No products found
because this supplier's products are not listed.
James P. Grayczyk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... heat inactivated FBS + 2 mM L-glutamine + 100 IU/mL penicillin + 100 μg/mL streptomycin + 50 ng/mL recombinant human M-CSF (Gemini Bio-Products) for 6 days at 37°C ...
-
No products found
because this supplier's products are not listed.
Bert Vanmechelen, et al.,
bioRxiv - Microbiology 2022
Quote:
... using 6:1 TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI, USA). One and six days after transfection ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Bioengineering 2024
Quote:
... at 1 mg/mL and elastase at 6 U/mL (E-240, Goldbio) for 1 h ...
-
No products found
because this supplier's products are not listed.
Cierra K. Boyer, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 6 cm glass bottom dishes (Mattek) or 24-well plates as previously described18,68 ...
-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Moustoifa Said, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1-Amino-1-deoxy-D-fructose hydrochloride (fructosamine) was supplied by Carbosynth. 3-Aminophenylboronic acid hemisulfate salt (APBA) ...
-
No products found
because this supplier's products are not listed.
Yuting Zeng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The human EDN enzyme-linked immunosorbent assay (ELISA) kit (MBL International 7630, Woburn, MA) has a minimum detection limit of 0.62 ng/mL ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Danalyn R. Holmes, et al.,
bioRxiv - Plant Biology 2021
Quote:
... or α-CFBPase (cytosolic fructose-1,6-biphosphatase) (Agrisera Antibodies) and secondary α-mouse-HRP (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Arek Kendirli, et al.,
bioRxiv - Immunology 2022
Quote:
... or 1 nM fingolimod-P (FTY720 Phosphate, Biomol) for 90 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Adam S Hassan, et al.,
bioRxiv - Immunology 2019
Quote:
... 1 mM L-glutamine (all from Wisent Bioproducts), 0.05 mM 2-mercaptoethanol (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Nirupa Nagaratnam, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 6-cyclohexyl-1-hexyl-β-D-maltoside (Cymal-6) (Anatrace). Briefly ...
-
No products found
because this supplier's products are not listed.
Rui Cheng, et al.,
bioRxiv - Biochemistry 2020
Quote:
ATPase activity was quantified using PiColorLock™ phosphate detection system kit (Expedeon) that monitored the amount of free phosphate released ...
-
No products found
because this supplier's products are not listed.
Jan Fischer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SC102A-1 (System Bioscience) and chimpanzee Sandra A iPSC lines (Camp et al. ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Kevin D. de Young, et al.,
bioRxiv - Microbiology 2019
Quote:
... were grown in HIGG-1 mM phosphate overnight and treated with 200 µg mL−1 1-methyl-3-nitro-1-nitrosoguanidine (NTG, TCI America) for 50 minutes at 30 °C to induce DNA mutations ...
-
No products found
because this supplier's products are not listed.
M. Adelfio, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The pellet was then resuspended in 1 mL of isolation medium composed of 50 µL of DermaLife basal medium supplemented with L-Glutamine (6 mM) (Lifeline Cell Technologies, Frederick, MD), 10% Fetal Bovine Serum and 2.5 nM of L-Cysteine (Thermo-Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Lindsey A Allan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... human ACA (90C-CS1058 from Fitzgerald, 1:2000), rabbit Cyclin B1 (#12231S from Cell signalling technology ...
-
No products found
because this supplier's products are not listed.
Yuan Tian, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 0.5 M ammonium phosphate (Hampton Research) at 16 °C ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Marija Zivaljic, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rabbit anti-human TMPRSS2 (Atlas antibodies HPA035787, 1:1,000), rabbit anti-human actin (Sigma A2066 ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
Fructose (D-(-)-Fructose, Fruit sugar, levulose, fructosteril, D-fructofuranose,...
Cat# S5176, SKU# S5176-25mg,
25mg, $70.00
Ask
Xiao Qin, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... GDC-0941 (PI3K inhibitor, 1 µM, Selleck Chemical 50-851-6), PF-573228 (FAK inhibitor ...
-
No products found
because this supplier's products are not listed.
Daniel Bsteh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... for 6 cycles (1 min on/1 min off) on a Bioruptor Pico sonicator (Diagenode). For each ChIP reaction 4 % HEK293T-derived human spike-in lysate was combined with mESC lysate and incubated in 1x IP buffer (50 mM HEPES/KOH pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Gaurang Khot, Neil Shirtcliffe, Tansu Celikel,
bioRxiv - Biochemistry 2021
Quote:
... monosodium phosphate (NaH2PO4). Quartz capillaries (o.d. 1 mm, i.d. 0.5mm, length 7.5 cm) were purchased from Sutter Instruments. Deionised (Millipore ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Yonghui Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were expanded in human SMC growth medium kit (Cell Applications, Inc., 311K-500) under the standard culture condition (37 °C with 5% CO2 in a humid environment ...
-
No products found
because this supplier's products are not listed.
Jun Tominaga, et al.,
bioRxiv - Plant Biology 2020
Quote:
... a large 6 x 6 cm chamber (6800-13; LI-COR) was used to maximize measurement precision ...
-
No products found
because this supplier's products are not listed.
Ana Martinez-Val, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 1 mM beta-glycerol phosphate and 5 mM of sodium orthovanadate) using a syringe pump (Aladdin AL-1000, World precision instruments). Livers and right kidneys were quickly removed and snap frozen in liquid nitrogen ...
-
6 micro-well glass bottom plate with #1 cover glass(0.13-0.16mm), micro-well size 14mm, with...
Cat# P06-14-1-N,
20/case, $178.00
Ask
Giuseppe Dall’Agnese, et al.,
bioRxiv - Molecular Biology 2024
Quote:
1×106 cells were plated in a glass bottom 6-well plate (Cellvis, P06-1.5H-N) pre-treated with 5 μg/ml of poly-L-ornithine (Sigma ...
-
No products found
because this supplier's products are not listed.
Nikita Raj, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5-6 × 105 siRNA transfected or untransfected cells were cultured on collagen-coated 6-well plates (Ibidi, 80287) until 90-100 % confluency (20-24 hours) ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Roberto Jhonatan Olea-Ozuna, et al.,
bioRxiv - Microbiology 2024
Quote:
... or [33P] phosphate (1 Ci/mmol; American Radiolabeled Chemicals, Inc.). Cultures (1 ml ...
-
Phosphate Buffered Saline (PBS) 10X is formulated and prepared to use in conjunction with other...
Cat# 5076-100ML,
100 mL, USD $65.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2024
Quote:
... human (1 mg/mL, Advanced Biomatrix) and either GelMA (8.7% v/w ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and L-glutamine (Amresco 0374) were added back to the media to the concentration found in RPMI 1640 and L-Cystine (Amresco J993 ...
-
No products found
because this supplier's products are not listed.
Chiara Bernardini, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Internal standards including fructose-13C6 (for sugars) and sorbitol-13C6 (for sugar alcohols) were obtained from Toronto Research Chemicals (Toronto, ON, Canada) and Sigma-Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Callan M. Luetkemeyer, Corey P. Neu, Sarah Calve,
bioRxiv - Bioengineering 2023
Quote:
... Debrided samples were then stained in 1.5 mL 1 × phosphate buffered saline (PBS) with 1:500 Ghost Dye 780 (Tonbo Biosciences) and 3 drops NucBlue (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human procollagen type 1 antibody (LF68, ENH018) was purchased from Kerafast Inc ...
-
No products found
because this supplier's products are not listed.
Anthony L. Shiver, et al.,
bioRxiv - Systems Biology 2020
Quote:
... cultures were directly spotted onto a phosphate buffer saline 1% (w/v) agarose pad and phase contrast images were acquired using a Ti-E microscope (Nikon) with a 100X (NA ...
-
No products found
because this supplier's products are not listed.
Jesica Romina Canizo, et al.,
bioRxiv - Developmental Biology 2024
Quote:
E5 vitrified human embryos were thawed using a vitrification thaw kit (Irvine Scientific; 90137-SO) according to manufacturers’ recommendations ...
-
No products found
because this supplier's products are not listed.
Adam J. Widman, et al.,
bioRxiv - Genomics 2022
Quote:
... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Tamara Miljuš, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...