-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Mariam Taha, et al.,
bioRxiv - Microbiology 2023
Quote:
... b) 500 µL of 10% (v/v) human synovial fluid (BioIVT, Westbury, NY, USA) prepared in sterile Ringer’s solution (37) ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits were used to measure estrogen (Calbiotech ES180S-100), progesterone (IBL America ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Nicholas A. Rhoades, Thomas M. Hammond,
bioRxiv - Genetics 2021
Quote:
... Hygromycin B (Gold Biotechnology) was used at 200 μg per ml when selecting for hygromycin resistant strains ...
-
No products found
because this supplier's products are not listed.
Jennifer L. Reedy, et al.,
bioRxiv - Immunology 2023
Quote:
... For the R&D Duoset kits the ELISA were read using an i3X Spectrophotometer (Molecular Devices, LLC). For the LegendPlex assays ...
-
No products found
because this supplier's products are not listed.
Phyllis F Cheung, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Soluble PGRN levels in human plasma samples and culture supernatants were detected by a human PGRN ELISA kit (Adipogen Inc.). Please refer to the Supplementary Experimental Procedures for additional detail.
-
No products found
because this supplier's products are not listed.
Rebecca J. Burge, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 µM of human wild-type (Boston Biochem) or K63R ubiquitin (2B Scientific ...
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Neeltje van Doremalen, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were transfected with 100 ng of human or rhesus ACE2 receptor plasmid DNA using polyethylenimine (Polysciences). After 24 h ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... and supplemented with 20% human type A positive heat inactivated plasma (Valley Biomedical, Winchester, VA) in sterile ...
-
No products found
because this supplier's products are not listed.
Bruna Victorasso Jardim-Perassi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... a Fc receptor blocker (Tonbo Biosciences 70-0161-M001 ...
-
No products found
because this supplier's products are not listed.
Seong Su Kang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... MAO-B (GeneTex), MAO-A (GE healthcare) ...
-
No products found
because this supplier's products are not listed.
Marta Zaninello, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 250 μg/ml Amphotericin B (Promocell), 1 μM cytosine arabinoside (Sigma) ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Seungjoon Kim, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit polyclonal anti-cholecystokinin-8 (Immunostar), mouse monoclonal anti-GAD67 (clone 1G10.2 ...
-
No products found
because this supplier's products are not listed.
Yuting Zeng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The human EDN enzyme-linked immunosorbent assay (ELISA) kit (MBL International 7630, Woburn, MA) has a minimum detection limit of 0.62 ng/mL ...
-
No products found
because this supplier's products are not listed.
Lars Borgards, et al.,
bioRxiv - Immunology 2023
Quote:
... The assay was performed according to the manufacturer’s instructions with a single technical replicate per sample (Uromodulin Human ELISA, BioVendor R&D, Cat. No.: RD191163200R; Azurocidin ELISA Kit, antibodies-online.com ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and levels of the IgG1 Fc moiety were measured by Human IgG ELISA Kit (Immunology Consultants Laboratory). To characterize different routes side-by-side ...
-
No products found
because this supplier's products are not listed.
Joseph E Kaserman, et al.,
bioRxiv - Cell Biology 2022
Quote:
Secreted total AAT was quantified from iHep supernatants using the human alpha-1-antitrypsin ELISA quantification kit (GenWay Biotech) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Hiroaki Tsukano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... we used a low-salt type cholera toxin subunit b (CTB) (#104; List Biological Laboratory, Campbell, CA) that is suitable for iontophoretic injection (Ruigrok et al. ...
-
No products found
because this supplier's products are not listed.
Yash Agarwal, et al.,
bioRxiv - Immunology 2020
Quote:
... Paraffin embedded fixed sections were stained via hematoxylin and eosin or with indicated human antibodies 24 (anti-human CD45-Biocare Medical Cat. No. CME PM016AA; anti-human CD3-Biocare Medical Cat. No. CME 324 A, B, C; anti-human CD68-Biocare Medical catalog number CM 033 A ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Dario De Felice, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... ECL LiteAblot plus kit A+B (Euroclone, GEHRPN2235) was used to detect immunoreactive bands with an Alliance LD2 device and software (UVITEC) ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Fc receptor blocker (Innovex Biosciences), and finally avidin/biotin blocking buffer (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Julia Ickler, et al.,
bioRxiv - Immunology 2019
Quote:
... Cells were cultivated in RPMI1640 with 10% human serum (Type AB, Pan Biotech, Aidenbach, Germany), 1% Penicillin/Streptomycin (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Hua Shen, Ryan A. Lane,
bioRxiv - Bioengineering 2023
Quote:
... Conditioned medium from the culture was collected to determine tendon cell type I collagen production using a Mouse Type I Collagen Detection Kit (Chondrex). The cells were lysed to assess cell proliferation with a CyQUANT™ Cell Proliferation Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
A. Chansard, et al.,
bioRxiv - Immunology 2020
Quote:
... the cells were incubated with a monoclonal anti-human NF-B p65 antibody (27F9.G4, 1/2000, Rockland) diluted in the blocking solution (PBS-milk 5% ...
-
No products found
because this supplier's products are not listed.
Lei Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Type R1 (Trevigen) according to established methods (Sato et al. ...
-
No products found
because this supplier's products are not listed.
Markus Brandhofer, et al.,
bioRxiv - Immunology 2022
Quote:
... isolated CD4+ human T cells (3.5 × 106) were seeded in a rat tail collagen type-I gel (Ibidi, Munich, Germany) in DMEM and subjected to a gradient of human MIF ...
-
No products found
because this supplier's products are not listed.
Norin Chaudhry, et al.,
bioRxiv - Cell Biology 2021
Quote:
For Magic red staining (Cathepsin-B Assay Kit; Immunochemistry Technologies LLC, Bloomington, MN, USA), larvae were starved for 4 h in 20% sucrose (supplemented with heat inactivated yeast for fed controls) ...
-
No products found
because this supplier's products are not listed.
Erich D. Jarvis, et al.,
bioRxiv - Genomics 2022
Quote:
... All data types (Pacbio CLR ...
-
LC Laboratories' Product Number G-5903 - GW2580, Free Base (cFMS Receptor Tyrosine Kinase...
Cat# G-5903, SKU# G-5903_10g,
10 g, $2670.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Ryoji Amamoto, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Tweezer-type electrodes (Harvard Apparatus, BTX ...
-
No products found
because this supplier's products are not listed.
Altair C. Hernandez, et al.,
bioRxiv - Cell Biology 2024
Quote:
● Immersion Oil type F2 (Nikon).
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Manu De Groeve, Bram Laukens, Peter Schotte,
bioRxiv - Microbiology 2023
Quote:
... 2 L or 5 L scale (Biostat B-plus and B-DCU units, Sartorius Stedium Biotech) as previously described [PMID ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Josie L Ferreira, et al.,
bioRxiv - Microbiology 2022
Quote:
... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...