-
No products found
because this supplier's products are not listed.
Yuling Han, et al.,
bioRxiv - Microbiology 2020
Quote:
... in the presence of SFD containing either a combination of five factors (3 μM CHIR99021, 10 ng/ml human FGF10, 10 ng/ml human FGF7, 10 ng/ml human BMP-4, and 50 nM ATRA), or three factors (3 μM CHIR99021 ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Tino Pleiner, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... translations were performed in the presence of 10 μM HA- or His-tagged Ubiquitin (Boston Biochem, USA). Denaturing immunoprecipitation of the ubiquitinated species was performed as previously described (Yanagitani et al. ...
-
No products found
because this supplier's products are not listed.
Oswaldo Tostado-Islas, et al.,
bioRxiv - Microbiology 2020
Quote:
... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Nadja I. Lorenz, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml human recombinant basic fibroblast growth factor (bFGF) (ReliaTech, Wolfenbüttel, Germany).
-
No products found
because this supplier's products are not listed.
Federica Fabro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... human basic fibroblast growth factor (FGF; 20 ng/mL) (both from Tebu-Bio), and heparin (5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Grant Kemp, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The PUREfrex in vitro transcription-translation system was produced by Eurogentec and purchased via BioNordika ...
-
No products found
because this supplier's products are not listed.
Dongsoo Lee, Juyoung Kim, Stephen A. Baccus,
bioRxiv - Neuroscience 2024
Quote:
... Translation was controlled by a motorized micromanipulator (MP-285A, Sutter Instrument). Emission light was directed to a long-pass dichroic mirror (FF775-Di01 ...
-
No products found
because this supplier's products are not listed.
Eva Kummer, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... After another 3 min at 37 °C the termination complexes were placed on ice for 15 min and subsequently applied to Quantifoil R2/2 holey carbon grids (Quantifoil Micro Tools) either coated with a thin continuous carbon film or with graphene oxide flakes (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... V5 (1:400, human, Absolute Antibodies #AB00136-10.0); Myc (1:400 ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Platelet-activating Factor was from Avanti polar Lipids, Alabaster ...
-
No products found
because this supplier's products are not listed.
Gabriella Fioravanti, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50 ng/mL nerve growth factor (Envigo NGF 2.5S), or 5nM ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Gabriele Flossmann, et al.,
bioRxiv - Genomics 2020
Quote:
... Library preparation followed ultrasonic fragmentation (Covaris: 50 s, 5% duty factor) using the Illumina TruSeq DNA PCR-Free Sample Preparation Kit with an insert size of 350 bp ...
-
No products found
because this supplier's products are not listed.
Rendy Hosea, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Human genome DNA extracted from HCT116 cells using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China) was used as template for amplifying the promoter regions ...
-
A component of the Papain Dissociation System, for use in the tissue dissociation method of...
Cat# LK003178,
5 vi, $98.00
Ask
Marco Bauzá-Thorbrügge, et al.,
bioRxiv - Physiology 2022
Quote:
Human adipocytes were isolated from adipose tissue samples by collagenase (type 1, Worthington, NJ, USA) as described previously [24] ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Durgadevi Parthasarathy, et al.,
bioRxiv - Microbiology 2023
Quote:
293F cells were co-transfected with a SOSIP-expressing plasmid and a human furin-expressing plasmid at a 4:1 ratio (4 SOSIP : 1 furin) using polyethyleneimine (PEI; Polysciences, Inc. Warrington, PA). Transfected cells were grown for 3-5 days in a tissue culture incubator at 37°C ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Tamara Miljuš, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
For all experiments human embryonic kidney (HEK) 293SL cells84 were used and regularly tested for mycoplasma contamination (PCR Mycoplasma Detection kit, ABM, Canada). HEK293SL cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
No products found
because this supplier's products are not listed.
Baishakhi Ghosh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary non-diseased human bronchial epithelial (NHBE) and COPD human bronchial epithelial (CHBE) cells were purchased from MatTek Life Sciences (Ashland ...
-
No products found
because this supplier's products are not listed.
Wei-Li Ling, Samuel Ken-En Gan,
bioRxiv - Immunology 2022
Quote:
KD measurements of Fc-tagged Human FcμR (Cat: 13556-H02H, SinoBiological) immobilised on Anti-Human IgG Fc (AHC) (Cat: 18-5060, Sartorius) biosensors were performed on the Octet Red96® system with the loading threshold set at 1.0 nm and utilizing the recombinant Pertuzumab and Trastuzumab IgM VH whole antibodies variants in five serial diluted concentrations (12.5 to 200nM ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human neurons were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For quantification of Panx1 plasma concentration in AAA patients a human Panx1 ELISA (#39097, Signalway Antibody) was performed ...
-
Cat# HY-P70290-10 μg,
10 μg, USD $170.0
Ask
Huan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Teriparatide (Human parathyroid hormone-(1-34)) (MedChemExpress), Glu (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Caroline Atyeo, et al.,
bioRxiv - Immunology 2021
Quote:
... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chen Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and labeled by nick translation Abbott Laboratories (cat. # 07J00-001. The hybridization signals were measured using the Z series photos taken on a Nikon Eclipse Ti-E inverted fluorescence microscope ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human procollagen type 1 antibody (LF68, ENH018) was purchased from Kerafast Inc ...
-
No products found
because this supplier's products are not listed.
Jesica Romina Canizo, et al.,
bioRxiv - Developmental Biology 2024
Quote:
E5 vitrified human embryos were thawed using a vitrification thaw kit (Irvine Scientific; 90137-SO) according to manufacturers’ recommendations ...
-
No products found
because this supplier's products are not listed.
Parker C. Wilson, et al.,
bioRxiv - Genomics 2022
Quote:
CUT&RUN assay libraries for cultured cells or human kidneys were generated with the CUTANA kit (EpiCypher, 14-1048). For cultured cells ...
-
No products found
because this supplier's products are not listed.
Fabrizia Zevolini, et al.,
bioRxiv - Immunology 2023
Quote:
... CTLs at 5 days of differentiation were transiently transfected using the Human T cell nucleofector kit and the program T-023 of the Nucleofector II system (Amaxa Biosystems, Euroclone, Milan, Italy) for activated cells with 1 μg/106 cells of pEGFP-EB1 plasmid ...
-
No products found
because this supplier's products are not listed.
Francisco J. Pardo-Palacios, et al.,
bioRxiv - Genomics 2023
Quote:
... in human and from 2.5 (cDNA-PacBio) to 1.38 (dRNA-ONT) ...
-
No products found
because this supplier's products are not listed.
Cesare Granata, et al.,
bioRxiv - Physiology 2019
Quote:
... and mitochondrial transcription factor A (TFAM) were quantified by quantitative real-time PCR (Mastercycler® RealPlex2, Eppendorf, Germany), using SYBR Green chemistry (iTaqTM Universal SYBR® Green Supermix ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and Halo-tagged upstream binding factor (AICS-0086 cl.147) were plated on Matrigel coated Ibidi 35 mm µ-Dishes (Ibidi, #81156). The cells were then imaged using a CSU-W1 spinning disc (Yokogawa ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.