-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Alison K Francois, et al.,
bioRxiv - Microbiology 2023
Quote:
... and cultured with 5 ng/ml human fibroblast growth factor (FGF, Gemini Bio-Products 300-113P) throughout clonal selection ...
-
No products found
because this supplier's products are not listed.
Islam E. Elkholi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10 ng/mL Epidermal growth factor (BPS bioscience #90201-1), 10 umol/L Y-27632 (Abmole #M1817) ...
-
No products found
because this supplier's products are not listed.
Noy Sadot Muzika, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Successful calli initiations (80%-100%) were characterized at 21- and 28-days post culturing using stereomicroscope (Nikon SMZ25, X5 magnification) and viewed using NIS-elements program (Nikon) ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Gabriele Flossmann, et al.,
bioRxiv - Genomics 2020
Quote:
... Library preparation followed ultrasonic fragmentation (Covaris: 50 s, 5% duty factor) using the Illumina TruSeq DNA PCR-Free Sample Preparation Kit with an insert size of 350 bp ...
-
No products found
because this supplier's products are not listed.
Baishakhi Ghosh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary non-diseased human bronchial epithelial (NHBE) and COPD human bronchial epithelial (CHBE) cells were purchased from MatTek Life Sciences (Ashland ...
-
No products found
because this supplier's products are not listed.
Francisco J. Pardo-Palacios, et al.,
bioRxiv - Genomics 2023
Quote:
... in human and from 2.5 (cDNA-PacBio) to 1.38 (dRNA-ONT) ...
-
No products found
because this supplier's products are not listed.
Cesare Granata, et al.,
bioRxiv - Physiology 2019
Quote:
... and mitochondrial transcription factor A (TFAM) were quantified by quantitative real-time PCR (Mastercycler® RealPlex2, Eppendorf, Germany), using SYBR Green chemistry (iTaqTM Universal SYBR® Green Supermix ...
-
No products found
because this supplier's products are not listed.
Wei-Li Ling, Samuel Ken-En Gan,
bioRxiv - Immunology 2022
Quote:
KD measurements of Fc-tagged Human FcμR (Cat: 13556-H02H, SinoBiological) immobilised on Anti-Human IgG Fc (AHC) (Cat: 18-5060, Sartorius) biosensors were performed on the Octet Red96® system with the loading threshold set at 1.0 nm and utilizing the recombinant Pertuzumab and Trastuzumab IgM VH whole antibodies variants in five serial diluted concentrations (12.5 to 200nM ...
-
No products found
because this supplier's products are not listed.
Xindi Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-human IBA1 (Aves Labs, IBA1-0020), mouse anti-human TMEM119 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Théo Juncker, et al.,
bioRxiv - Immunology 2023
Quote:
The coding sequence of the Dnmt1-chromobody targeting the human Dnmt1 protein [37] (Uniprot : P26358 · DNMT1_HUMAN) and lamin-chromobody (ChromoTek) targeting the lamin D0 from Drosophila monogaster (Uniprot ...
-
No products found
because this supplier's products are not listed.
Federica Fabro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... human basic fibroblast growth factor (FGF; 20 ng/mL) (both from Tebu-Bio), and heparin (5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Yuling Han, et al.,
bioRxiv - Microbiology 2020
Quote:
... in the presence of SFD containing either a combination of five factors (3 μM CHIR99021, 10 ng/ml human FGF10, 10 ng/ml human FGF7, 10 ng/ml human BMP-4, and 50 nM ATRA), or three factors (3 μM CHIR99021 ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Grant Kemp, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The PUREfrex in vitro transcription-translation system was produced by Eurogentec and purchased via BioNordika ...
-
No products found
because this supplier's products are not listed.
Dongsoo Lee, Juyoung Kim, Stephen A. Baccus,
bioRxiv - Neuroscience 2024
Quote:
... Translation was controlled by a motorized micromanipulator (MP-285A, Sutter Instrument). Emission light was directed to a long-pass dichroic mirror (FF775-Di01 ...
-
Cat# HY-P70290-10 μg,
10 μg, USD $170.0
Ask
Huan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Teriparatide (Human parathyroid hormone-(1-34)) (MedChemExpress), Glu (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Caroline Atyeo, et al.,
bioRxiv - Immunology 2021
Quote:
... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... human epithelial cell (HEC) media with the supplemental kit was purchased from Cell Biologics Inc ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human procollagen type 1 antibody (LF68, ENH018) was purchased from Kerafast Inc ...
-
No products found
because this supplier's products are not listed.
Eirik S. Nilssen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Images of cFOS+ neurons were obtained from an automated fluorescent scanner as described previously (see Immunohistochemistry and imaging) and were subsequently downsampled by a factor of 1:2 and converted from Carl Zeiss file format (.czi ...
-
Gliadin ELISA Kit
Cat# EGLD-100,
1.0 kit, 96 tests, USD $519.0
Ask
Yehezqel Elyahu, et al.,
bioRxiv - Immunology 2024
Quote:
... The levels of AST and ALT in murine serum were measured using EnzyChrom™ ELISA kits for AST and ALT (BioAssay Systems) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Parker C. Wilson, et al.,
bioRxiv - Genomics 2022
Quote:
CUT&RUN assay libraries for cultured cells or human kidneys were generated with the CUTANA kit (EpiCypher, 14-1048). For cultured cells ...
-
No products found
because this supplier's products are not listed.
Fabrizia Zevolini, et al.,
bioRxiv - Immunology 2023
Quote:
... CTLs at 5 days of differentiation were transiently transfected using the Human T cell nucleofector kit and the program T-023 of the Nucleofector II system (Amaxa Biosystems, Euroclone, Milan, Italy) for activated cells with 1 μg/106 cells of pEGFP-EB1 plasmid ...
-
No products found
because this supplier's products are not listed.
Simona Selberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant human FTO protein was labeled with His-tag using Monolith His-Tag Labeling Kit RED-tris-NTA (NanoTemper Technologies GmbH; MO-L008). The labelled FTO protein (target ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and Halo-tagged upstream binding factor (AICS-0086 cl.147) were plated on Matrigel coated Ibidi 35 mm µ-Dishes (Ibidi, #81156). The cells were then imaged using a CSU-W1 spinning disc (Yokogawa ...
-
No products found
because this supplier's products are not listed.
Petros Zafeiriou, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Total starch content was determined using a Total Starch HK kit (Total Starch hexokinase kit, AOAC Method 996.1 1; Megazyme, Bray, IE) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Liangbo Qi, et al.,
bioRxiv - Biophysics 2019
Quote:
... 3.5 μl aliquots of the recombinant human TIM22 complex (7 mg ml-1) were dropped onto glow discharged holey carbon grids (Quantifoil Au R1.2/1.3, 300 mesh), blotted with a Vitrobot Mark IV (ThemoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Artyom A. Egorov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 mcg of total RNA was used for reverse transcription with MMLV-RT kit (Evrogen) according to the recommended protocol with oligo(dT)15 and random (dN)10 primers at a ratio of 1:3 ...
-
No products found
because this supplier's products are not listed.
Mustapha Dibbasey, Terry Gaymes,
bioRxiv - Cancer Biology 2021
Quote:
... Both HR plasmids (dl-1 and dl-2) and positive control plasmid were supplied with the Norgen’s Homologous Recombination kit (Norgen Biotek Corp., Thorold, ON, Canada). For each transfection ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and DCL-1 (Agrisera, diluted 1:100). For the localization of RNAPII we used antibodies recognizing RNAPII phosphorylated at serine 5 (Chromotek ...
-
No products found
because this supplier's products are not listed.
Xiaomei Sun, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and PACT kits (Molecular Dimensions, Anatrace, Inc.) at 20 ℃ ...
-
No products found
because this supplier's products are not listed.
Earric Lee, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 1 mm (WPI). The collected brain samples were stored in individual tubes at -20 °C until further analysis.
-
No products found
because this supplier's products are not listed.
James R. Bayrer, et al.,
bioRxiv - Physiology 2022
Quote:
... Antibodies used were against serotonin (1:5000, Immunostar, 1:500 Abcam), GFP (1:500 ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... V5 (1:400, human, Absolute Antibodies #AB00136-10.0); Myc (1:400 ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...