-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Brian T. Emmer, et al.,
bioRxiv - Genomics 2020
Quote:
... and addition of serum-free DMEM containing 4 μg/mL DyLight549-conjugated human LDL (Cayman Chemical, Ann Arbor MI, 10011229). Cells were incubated for 1 hr at 37°C then harvested with trypLE express ...
-
No products found
because this supplier's products are not listed.
Priya Bhardwaj, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The pieces were weighed and placed on a 10cm dish with 10mL of basal (phenol red free, serum free, and supplement mix free) mammary epithelial cell growth media (PromoCell #C-21215) containing 0.1% BSA ...
-
No products found
because this supplier's products are not listed.
Corey D. Holman, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... in DMEM/F12 containing 1% fatty acid-free bovine serum albumin (Gold Biotechnology) in a gentleMACS dissociator (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Aaqib Sohail, et al.,
bioRxiv - Immunology 2021
Quote:
... in serum-free DC medium (CellGenix) for 5 days.
-
No products found
because this supplier's products are not listed.
Samuel J. DePalma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 500 ug/mL human serum albumin (Sciencell Research Labs), and 213 ug/mL L-ascorbic acid 2-phosphate trisodium salt on day 11 for 4 days ...
-
No products found
because this supplier's products are not listed.
Shigeki Hirabayashi, et al.,
bioRxiv - Genomics 2019
Quote:
... cDNA libraries were constructed using Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Set B (Illumina) to deplete ribosomal RNA according to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Farizeh Aalam, et al.,
bioRxiv - Immunology 2020
Quote:
Infections were performed as described above except KSHV.219 virus was pre-incubated for 30 minutes on ice with serum free RPMI only or serum free RPMI containing recombinant human syndecan-1 protein (rhCD138, BioVision, 7879-10) prior to being added to Naïve B lymphocytes ...
-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated human serum albumin b-HSA (70 kg/mol, ACROBiosystems HSA-H82E3, Fisher Scientific), biotinylated heparan sulfate b-HS (synthesized using hydrazone ligation to 12 kg/mol HS and characterized by QCM-D to determine % of biotinylation as described in Thakar et al ...
-
No products found
because this supplier's products are not listed.
Kevin R. McCarthy, et al.,
bioRxiv - Microbiology 2020
Quote:
Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
No products found
because this supplier's products are not listed.
Brandon T Paradoski, et al.,
bioRxiv - Immunology 2024
Quote:
... Human B cell stimulation used 10ng/mL Goat F(ab’)2 Anti-human IgM (Southern Biotech #2022-01), 2ug/mL of recombinant human sCD40 (invitrogen PHP0025) ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, Jing Fan,
bioRxiv - Biochemistry 2020
Quote:
... and 0.1% Human Serum Albumin (Lee Biosolutions, 101-15), and kept at 37°C in incubators with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Nadine R King, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2 mg/ml Human Serum Albumin (HSA; Irvine Scientific), 10 μg/ml insulin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Helene De Bruyn, et al.,
bioRxiv - Physiology 2022
Quote:
... an AI module that is a part of the NIS-Elements NIS.ai suite (Nikon, Tokyo, Japan). We trained this neural network using a set of manually annotated fluoroscopy images in which the contrast-filled bladder was imaged from various angles and at different stages of the filling/voiding cycle ...
-
No products found
because this supplier's products are not listed.
Mehdi Damaghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
No products found
because this supplier's products are not listed.
Caroline Bull, Graham Mayrhofer, Michael Fenech,
bioRxiv - Cancer Biology 2019
Quote:
Human WIL2-NS (B lymphoblastoid) cells (American Type Culture Collection (ATCC); CRL-8155 ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jun-yi Zhu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... raised against human polyubiquitin-B and polyubiquitin-C (1:100) (BML-PW8810, Enzo Life Sciences); Rabbit polyclonal antibody against protein disulfide isomerase (1:100 ...
-
No products found
because this supplier's products are not listed.
Anne-Louise Latif, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were pelleted at 200g for 5 minutes and re-suspended in serum free RPMI media and cross-linked for 10 minutes on a rocker by adding 16% methanol-free paraformaldehyde (Alfa Aesar, 43368) (final concentration 1%) ...
-
No products found
because this supplier's products are not listed.
Heather R. Keys, Kristin A. Knouse,
bioRxiv - Genomics 2021
Quote:
... monoamine oxidase B (MAO-B) (1:1,000, Novus Biologicals NBP1-87493), lamin B2 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Jordan Wight, et al.,
bioRxiv - Microbiology 2024
Quote:
... Serum from 12 of these 19 samples were later re-tested using the IDEXX AI MultiS Screen Ab test (IDEXX Canada, Product # 99-12119) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yash Agarwal, et al.,
bioRxiv - Immunology 2020
Quote:
... Paraffin embedded fixed sections were stained via hematoxylin and eosin or with indicated human antibodies 24 (anti-human CD45-Biocare Medical Cat. No. CME PM016AA; anti-human CD3-Biocare Medical Cat. No. CME 324 A, B, C; anti-human CD68-Biocare Medical catalog number CM 033 A ...
-
No products found
because this supplier's products are not listed.
Guofang Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... human serum albumin (HSA, from Solarbio Science & Technology Co., Ltd. China), fibrinogen (FG ...
-
No products found
because this supplier's products are not listed.
Josie L Ferreira, et al.,
bioRxiv - Microbiology 2022
Quote:
... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
No products found
because this supplier's products are not listed.
James W. Opzoomer, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Spheroids in the Elplasia plate were then placed on ice and fixed in situ for 20 minutes on ice in 1% effective Formaldehyde added to the serum-free media (Formaldehyde, 16%, methanol-free, Ultra Pure; Polysciences #18814-20). The cell-fixation media was then removed and the cells were incubated with 50 mM TrisHCL (Thermo Scientific #J22638.AE ...
-
Prepared from cultures grown in medium completely devoid of animal based components and designed...
Cat# LS004150,
Bulk, Inquire
Ask
Eleni Stampouloglou, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... mechanically disrupted and digested in serum free media containing 2mg/ml collagenase type I (Worthington) and DNase I (Sigma ...
-
No products found
because this supplier's products are not listed.
Philip E. Stauffer, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... serum-free cell culture media and serially diluted within 384 well reservoir plates (Greiner, Ref 781280) using a Bravo automated pipette liquid handler (Velocity 11/Agilent) ...
-
No products found
because this supplier's products are not listed.
Kakon Nag, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The serum-free suspended cells were cultured in microbioreactor (Ambr® 15 cell culture bioreactor; Sartorius, Germany) to determine the specific productivity (Qp ...
-
No products found
because this supplier's products are not listed.
Seong Su Kang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... MAO-B (GeneTex), MAO-A (GE healthcare) ...
-
No products found
because this supplier's products are not listed.
Kelly O. Conger, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Two cohorts of mice (one sgLuc (N=5) and one sgSLC1A5-B (N=5)) were switched from standard chow to a serine and glycine free diet (Envigo, TD.160752) after palpable tumors had formed and food was replenished twice per week ...
-
No products found
because this supplier's products are not listed.
Lauren E. Stopfer, et al.,
bioRxiv - Bioengineering 2021
Quote:
... using 100 μg of pan-specific anti-human MHC Class I (HLA-A, HLA-B, HLA-C) antibody (clone W6/32, Bio X Cell) per 1e6 cells ...
-
No products found
because this supplier's products are not listed.
Dominic Henn, et al.,
bioRxiv - Cell Biology 2022
Quote:
... cells were serum starved one day before the assay by incubation in Human EC Basal Medium (Cell Applications) for 24 h ...
-
Cat# HY-K1012-100 mL,
100 mL, USD $165.0
Ask
Yong-Shan Zheng, et al.,
bioRxiv - Biochemistry 2024
Quote:
... the medium was removed and the activation solution (serum-free DMEM plus 1% BSA) containing varied concentrations of S1P (MedChemExpress) or recombinant MYDGF produced either from E ...
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
No products found
because this supplier's products are not listed.
James P Bridges, et al.,
bioRxiv - Cell Biology 2021
Quote:
... media was removed and replaced with serum-free Modified Eagles Medium (MEM; Mediatech) containing 1 µCi/ml of 3H-myo-inositol (PerkinElmer Life Sciences). Forty-eight hrs post-infection ...
-
No products found
because this supplier's products are not listed.
Swarnabh Bhattacharya, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Rho Activator II (Cytoskeleton, CN03-B), or Verteporfin (Sigma ...
-
No products found
because this supplier's products are not listed.
Xenia Dolde, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Approach 1 (human serum): Whole Blood was obtained from healthy adult volunteers and collected into Monovettes (7.5 ml, K3 EDTA, Sarstedt, Nümbrecht, Germany). Procedures were approved by the institutional review board (IRB ...
-
No products found
because this supplier's products are not listed.
Akihiro Kuno, et al.,
bioRxiv - Genomics 2021
Quote:
... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Amélie Fréal, et al.,
bioRxiv - Neuroscience 2023
Quote:
The AIS was imaged using an Olympus FV1000 confocal microscope (Olympus corporation, Tokyo, Japan) controlled by the imaging software FV10-ASW (Ver.03.00) ...
-
No products found
because this supplier's products are not listed.
Andres R. Henriquez, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Serum free fatty acids were measured using kits from Cell Biolabs, Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
To measure apoptosis 200 µL/well NucViewTM 530 red solution (2 µM in phenol red free and serum free RMPI medium) (Biotium) was added for 30 min at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Marissa Jeme Andersen, et al.,
bioRxiv - Microbiology 2021
Quote:
Human fibrinogen free from plasminogen and von Willebrand factor (Enzyme Research Laboratory #FB3) was diluted to 150ug/mL in PBS ...
-
No products found
because this supplier's products are not listed.
Aojia Zhuang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Nonspecific background staining was blocked via a serum-free protein blocker (BOSTER, USA) for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Caroline Lahogue, Didier Pinault,
bioRxiv - Neuroscience 2020
Quote:
... The EEG signals (0.1-800 Hz) were acquired using an ultralow-noise differential amplifier (AI 402, x50; Molecular Devices). All signals were sampled at 10 kHz 16-bit (Digidata 1440A with pCLAMP10 Software ...
-
GW590735 is a potent and selective PPARalpha agonist. It stimulated PPARalpha with an EC50 of 4...
Cat# G-7322, SKU# G-7322_25mg
,
25 mg, $148.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Simon Roux, et al.,
bioRxiv - Microbiology 2019
Quote:
... free dNTPs and primers (Zymo Research) and subsequently used as templates for Sanger sequencing ...