-
No products found
because this supplier's products are not listed.
Teresa R. Wagner, et al.,
bioRxiv - Immunology 2023
Quote:
... purified antigen (Acrobiosystems) was reacted with Sulfo-NHS-LC-LC-Biotin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Alyssa N Coyne, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Antigen retrieval was performed using Tissue-Tek antigen retrieval solution (IHC World) for 1 hour in a steamer ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... goat anti- xenotropic MLV virus antibody ABIN457298 (1:1000, antibodies-online); mouse anti- MLV gag ab100970 (1:1000 ...
-
No products found
because this supplier's products are not listed.
CE Fain, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Virus was delivered to the right hemisphere of the brain via automatic 1 mL Hamilton syringe (Hamilton Company, Reno, NV). Mice were euthanized for high-dimensional flow cytometry of tissues at 7-days post infection (dpi).
-
No products found
because this supplier's products are not listed.
Dilyana Georgieva Kirova, et al.,
bioRxiv - Cell Biology 2022
Quote:
... In every replicate 1 – 2 mg BTD-labeled lysate was clicked to Az800 (AzDye 800 – Click Chemistry tools) as described above ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Danielle L. Tomasello, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Antibodies: 1:00 Synaptotagmin-1 (Lifespan Bioscience), GAD65 + GAD67 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Ethan Iverson, et al.,
bioRxiv - Microbiology 2021
Quote:
... recombinant human IFNβ (1 nM, 11415-1, PBL Assay Science), IFNλ3 (10 nM ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... prepared as a 1:1 mixture of DMEM/F12 (PAN Biotech) and Neuropan basal medium (PAN Biotech ...
-
Cat# H1K237-5,
USD $1095.0/kit
Ask
Nisha R. Dhanushkodi, et al.,
bioRxiv - Immunology 2021
Quote:
... HSV-1 gD antigen (Virusys Corporation, Taneytown, MD) was coupled using FITC or AP lightning kit (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Qiulong Yan, et al.,
bioRxiv - Microbiology 2020
Quote:
The DNA and RNA of virus were extracted by using TIANamp Virus DNA / RNA Kit (TIANGEN) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Ferdinand Roesch, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in RPMI-1640 (Genesee Scientific) media containing 2% FBS and 10 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
... biotinylated recombinant antibodies that were able to bind the antigen were detected with 1/10,000 poly-HRP-conjugated streptavidin (Sanquin) diluted in PTA buffer (100 μL/well ...
-
No products found
because this supplier's products are not listed.
Stuti Mehta, et al.,
bioRxiv - Molecular Biology 2022
Quote:
AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
No products found
because this supplier's products are not listed.
Evgeniya N. Andreyeva, et al.,
bioRxiv - Biochemistry 2022
Quote:
... coli (ISWI, ModT antigen and LCMS reference proteins) or obtained from EpiCypher Inc ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The virus titers were measured by flow cytometry assay (Expression Systems).
-
No products found
because this supplier's products are not listed.
Chung-Yueh Yeh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The cleared lysate was passed through 1 ml of PureCube Ni-NTA agarose column (Cube Biotech). The column was washed three times with N300 (50mM Hepes*NaOH pH 7.6 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
WB, IHC,ELISA
Cat# A5233, SKU# A5233-100ul,
100ul, $157.00
Ask
Qiong Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus quantification by real-time PCR was performed using the QPCR Mix (Bimake, Cat#B21202), following the supplier’s instruction ...
-
No products found
because this supplier's products are not listed.
Paul A. Rowley, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Human brain and testes tissue total protein lysates were purchased from ProSci Incorporated (catalogue numbers 1303 and 1313 ...
-
No products found
because this supplier's products are not listed.
Guus Franken, et al.,
bioRxiv - Immunology 2023
Quote:
... Serially diluted lysates were arrayed on nitrocellulose-coated slides (Grace Bio-Labs) by the Quanterix (Aushon ...
-
No products found
because this supplier's products are not listed.
Michael D. Vahey, Daniel A. Fletcher,
bioRxiv - Microbiology 2019
Quote:
... replacing media with virus growth media supplemented with or without a specified concentration of oseltamivir carboxylate (Toronto Research Chemicals O700980), but without TPCK-treated trypsin ...
-
No products found
because this supplier's products are not listed.
Sara Al Rawi, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fbxo7 was immunoprecipitated from cell lysates using 2μl of anti-Fbxo7 antibody (Aviva), or isotype matched control ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The lysates of human femoral osteoblasts and human calvarial osteoblasts were purchased from ScienCell Research Laboratories (Cat ...
-
No products found
because this supplier's products are not listed.
Jun Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Whole-cell lysates (200 μg protein/sample) were incubated with UbiQapture-Q Matrix (Biomol) by gentle agitation at 4°C overnight to pull down all ubiquitinated proteins according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michael J. Cohen, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cytosolic lysate was covalently modified with or without 1mg/mL sulfo-NHS-LC biotin (ApexBio) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Flavia Ferrantelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... virus dilutions and number of deaths/group after challenge were used to calculate the LD50 (Quest Graph™ LD50 Calculator, AAT Bioquest, Inc.). The Kaplan-Meier curve was used to show survival rate differences among groups of animals challenged with different doses of SARS-CoV-2 virus ...
-
No products found
because this supplier's products are not listed.
Aleksandr Andriianov, et al.,
bioRxiv - Microbiology 2023
Quote:
... Wells were screened by PCR for the presence of lysate with recombinant phages and T3Δ0.3 was further purified from individual plaques and verified by Sanger sequencing (Evrogen).
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Rana Soylu-Kucharz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... vasopressin (1:10000, Chemicon) and oxytocin (1:2000, Phoenix Pharmaceuticals), anti-hypocretin (1:4000 ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Collagen 1 (concentration 5 μg ml−1; PureCol EZ Gel, Advanced BioMatrix) supplemented with Fibronectin (25 μg ml−1 ...
-
No products found
because this supplier's products are not listed.
Marija Mihailovich, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were then cultured in MEM1 (DMEM/F12 1:1 (Euroclone/Gibco) supplemented with NEAA 1% ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Caio César Barbosa Bomfim, et al.,
bioRxiv - Microbiology 2024
Quote:
... ACE2 (Biorbyt; 1:25) or TMPRSS2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... rabbit anti-β-gal (1:200, ICL), rat anti-Elav (1:100 ...
-
No products found
because this supplier's products are not listed.
Matthew D. Lauver, et al.,
bioRxiv - Immunology 2022
Quote:
... Virus dilutions were combined 1:1 with 0.45% sheep erythrocytes (Innovative Research) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Nikol Dibus, et al.,
bioRxiv - Cell Biology 2023
Quote:
... lysates were incubated with the PD-1 antibody (1 µg; Exbio #11-176) and mixed with Dynabeads® Protein G ...
-
No products found
because this supplier's products are not listed.
Nils H. Rustmeier, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 20 mM A antigen trisaccharide (all purchased from Biosynth, UK), and 20 mM Tf antigen (TCI Europe) ...
-
No products found
because this supplier's products are not listed.
Robert C. Hurt, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a lysate clearing plate from Bio Basic (SD5006), and a DNA-binding plate from Epoch Life Sciences (2020-001) ...
-
No products found
because this supplier's products are not listed.
Charul Jani, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lysates were run on a 10% acrylamide gel (National Diagnostics) in 1X Tris-Glycine SDS Running Buffer (Boston BioProduct ...
-
No products found
because this supplier's products are not listed.
Heather Felgate, et al.,
bioRxiv - Genomics 2022
Quote:
... For Illumina sequencing DNA was extracted from the lysate with the Quick-DNA Fungal/Bacterial 96 kit (Cambridge Bioscience), in accordance with the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Rémi Ronzano, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-mCherry (1:1000 to 1:2000, EnCor Biotechnology), mouse IgG2a anti-GAD67 (clone 1G10.2 ...
-
No products found
because this supplier's products are not listed.
Francesca Puppo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 1% Penicillin streptomycin) supplemented with 1% fetal bovine serum (FBS, Gemini Bio-products), 1 μg/ml of laminin and 0.1% ROCK (Rho kinase ...