-
No products found
because this supplier's products are not listed.
Arne Knörck, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-human CD95 Apo 1-1 was from Enzo Life Sciences. Flow Cytometry antibodies (for details see Flowcytometry ...
-
No products found
because this supplier's products are not listed.
Joan Sebastián Gallego-Murillo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... human plasma-derived holotransferrin (1 mg/mL; Sanquin; Netherlands), and heparin (5 U/mL ...
-
No products found
because this supplier's products are not listed.
Stefano Testa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... APC-A750 anti-human CD90 (Thy-1/310, #B36121 Beckman Coulter) and Vioblue anti-human CD45 antibodies (REA747 ...
-
No products found
because this supplier's products are not listed.
David Tischfield, et al.,
bioRxiv - Immunology 2020
Quote:
... autochthonous HCCs were induced in male Wistar rats (Charles River Laboratories) using an established protocol including ad libitum oral intake of 0.01% diethylnitrosamine (DEN ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Morten S. Hansen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... human GIP (0.1, 1, 10 and 100nM, Bachem), human GIP(3-30)NH2 (10µM ...
-
No products found
because this supplier's products are not listed.
Matthew J. Reynolds, et al.,
bioRxiv - Biophysics 2022
Quote:
... Lyophilized human cofilin 1 was purchased from Cytoskeleton (CF01) and reconstituted in MB buffer (20 mM MOPS pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Yu Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and rabbit-anti-human S100 (1:100, CP021A, Biocare) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Evangelos Stefanidis, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1% Penicillin/Streptomycin and 50ng/ml human M-CSF (ImmunoTools) for 7 days and harvesting the adherent fraction ...
-
No products found
because this supplier's products are not listed.
Tyler N. Starr, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Recombinant human ACE2 (Uniprot: Q9BYF1-1) was purchased from ACROBiosystems (AC2-H82E6), consisting of residues 18-740 spanning an intrinsic dimerization domain ...
-
No products found
because this supplier's products are not listed.
Valeria Manriquez, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the human vasculature with 100μg of Dylight755-conjugated UEA-1 lectin (Unconjugated UEA-1 lectin, Vector Laboratories, #L-1060 + DyLight755 Antibody Labelling Kit ...
-
No products found
because this supplier's products are not listed.
Georgios Theocharidis, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Whole slide image acquisition was performed at the DF/HCC Research Pathology Cores with an Aperio CS2 scanner (Leica Biosystems). Re-epithelialization was quantified from MTS images by measuring the length of the migrating epithelial tongue covering the wound and dividing by the entire length of the wound ...
-
No products found
because this supplier's products are not listed.
Jan Fischer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SC102A-1 (System Bioscience) and chimpanzee Sandra A iPSC lines (Camp et al. ...
-
No products found
because this supplier's products are not listed.
Masahiko Nishitani-Isa, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit polyclonal anti-human pyrin (AdipoGen, 1:2000), mouse monoclonal anti Rho-GDI (Santa-Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Marija Zivaljic, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rabbit anti-human TMPRSS2 (Atlas antibodies HPA035787, 1:1,000), rabbit anti-human actin (Sigma A2066 ...
-
No products found
because this supplier's products are not listed.
Oliver J. Gough, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Negative Control Primer Set 1 (Active Motif, #71001), Human Negative Control Primer Set 3 (Active Motif ...
-
No products found
because this supplier's products are not listed.
Natasha S. Kelkar, et al.,
bioRxiv - Immunology 2023
Quote:
... 1:300 dilution of ms-anti-human-C3b (Cedarlane Labs, CL7636AP) was added as primary antibody while goat anti-ms-IgG-PE ...
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Ammar Zaghlool, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10^5 human SHSY-5Y cells seeded on 18 mm #1 round cover glass (VWR) in a 12 well culture plate ...
-
No products found
because this supplier's products are not listed.
Trine Lisberg Toft-Bertelsen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or humans (MBS707296, MyBioSource). The CSF samples were added to wells pre-coated with LPA antibody ...
-
No products found
because this supplier's products are not listed.
Kang Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-human SLC7A11(Abclonal, #A13685, 1:1000), anti-human GPX4(Abcam ...
-
No products found
because this supplier's products are not listed.
Will Macnair, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-human GPR17 (Cayman Chemical, 10136, 1:100), MBP (Rat anti MBP aa82-87 BioRad 1:300) ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Dennis J. Doorduijn, et al.,
bioRxiv - Microbiology 2021
Quote:
... for C5b6 with 1:500 dilution of goat-anti human C5 serum (Complement Technology) and for sMAC with 1 µg/ml biotinylated monoclonal anti-C7 (clone F10 ...
-
No products found
because this supplier's products are not listed.
Jianing Song, et al.,
bioRxiv - Biochemistry 2020
Quote:
... human BDNF (2837, Tocris), PACAP-38 (4031157 ...
-
No products found
because this supplier's products are not listed.
Alice Lu-Culligan, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated with 20 ng per well of human Syncytin-1 recombinant protein (Abnova #H00030816-Q01) in PBS and were incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Lindsey A Allan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... human ACA (90C-CS1058 from Fitzgerald, 1:2000), rabbit Cyclin B1 (#12231S from Cell signalling technology ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... V5 (1:400, human, Absolute Antibodies #AB00136-10.0); Myc (1:400 ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Ibtesam Rajpar, Jennifer G. Barrett,
bioRxiv - Cell Biology 2019
Quote:
... and 10ng/ml IGF-1 (recombinant human, BioVision, San Francisco, CA). Media was changed on alternate days over a 10-day period.
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse anti Cav α1E 1:1000 (Synaptic Systems, 152411, human neurons), rabbit anti CDKL5 1:2000 (Atlas ...
-
No products found
because this supplier's products are not listed.
Lih-Yun Hsu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Human IL-2 concentration was measured with the AlphaLISA human IL2 Kit (PerkinElmer) and data collected on an Envision Plate Reader (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Anne-Claire Langlois, et al.,
bioRxiv - Microbiology 2020
Quote:
Human HDL lipoproteins (LP3, Calbiochem) were labeled using the Cy5 monoreactive Dye pack (PA25001 ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Baishakhi Ghosh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary non-diseased human bronchial epithelial (NHBE) and COPD human bronchial epithelial (CHBE) cells were purchased from MatTek Life Sciences (Ashland ...
-
No products found
because this supplier's products are not listed.
Jessica Ciesla, Isreal Moreno Jr., Joshua Munger,
bioRxiv - Microbiology 2022
Quote:
TNFα (Human) was purchased from GoldBio (#1130-01-100) and suspended in sterilized water to 1 mg/mL concentration ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Marina Boudigou, et al.,
bioRxiv - Immunology 2021
Quote:
... Pancoll human (PAN Biotech). CD19+ B cells were purified from human PBMCs using the REAlease® CD19 Microbead Kit (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
S. Jordan Kerns, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human alveolar epithelial cells (Cell Biologics, Accegen) were cultured using SABM medium (Lonza ...
-
No products found
because this supplier's products are not listed.
Babek Alibayov, et al.,
bioRxiv - Microbiology 2022
Quote:
... Human serum was purchased from MP Biomedicals.
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Changsheng Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human retinal microvascular endothelial cells (HRMECs, Cell System) were cultured in a complete classic medium supplemented with/without high-content glucose (50 or 100 mM) ...
-
No products found
because this supplier's products are not listed.
Dedrick Kok Hong Chan, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-human FBXW7 antibody (1:2500, BS-8394R, Bioss, USA), rabbit anti-human phosphor-CJUN antibody (1:2500 ...
-
No products found
because this supplier's products are not listed.
Eike K. Mahlandt, et al.,
bioRxiv - Cell Biology 2021
Quote:
... BOECs were stimulated with 1 U/ml human α-thrombin (HCT-0020, Haematologic technologies) diluted in phosphate-buffered saline.
-
No products found
because this supplier's products are not listed.
Jan Steinkühler, et al.,
bioRxiv - Biophysics 2020
Quote:
... Human Transferrin – CF488A (Biotium) at 130 nM ...