-
No products found
because this supplier's products are not listed.
Anjali Patwardhan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... marburgensis was cultured on H2/CO2 (80/20%) at 65 °C in a 14-liter fermenter (New Brunswick Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Cintia Horta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
No products found
because this supplier's products are not listed.
Grégory Menchon, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Reverse-transfections of siRNAs were performed in 60mm dishes (standard - Sarstedt) with 220,000 cells per dish and for 48h in decomplemented Mc Coy’s 5A medium without antibiotics ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Chuan Chen, et al.,
bioRxiv - Immunology 2022
Quote:
... Grids were cleaned with H2/O2 gas mixture for 15 s in PELCO easiGlow glow discharge unit (Ted Pella) and 1.8 μl of protein suspension was applied to the surface of the grid ...
-
No products found
because this supplier's products are not listed.
Natalia Kruglova, et al.,
bioRxiv - Microbiology 2021
Quote:
... addition of 8 amino acids from the HIV gp41 (H2) and mutation of the furin cleavage site PRRA⟶A (ΔA) were introduced by PCR with Pfu polymerase (Sibenzyme, Russia) and verified by sequencing ...
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Shabirul Haque, Sarah R. Vaiselbuh,
bioRxiv - Cancer Biology 2020
Quote:
Exosomes were labeled with TexRed-siRNA (SBI System Bioscience) as per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Maximilian F. Madern, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... RNA from siRNA-treated cells was isolated using TRIsure (Bioline). Next ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5μl of Lipofectamine and 20 nM of each siRNA were diluted and incubated in Opti-MEM (Alfagene) for 30 min ...
-
No products found
because this supplier's products are not listed.
Sumeda Nandadasa, et al.,
bioRxiv - Biochemistry 2022
Quote:
... with or without siRNA treatment were seeded onto glass-bottom dishes (MatTek, catalog no. P35G-0-14-C) in phenol-red free medium and imaged at 30 min or 24 hrs after seeding ...
-
No products found
because this supplier's products are not listed.
Mohammed Ghiboub, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-8 and TNF from SP140 siRNA or scrambled-treated M1 macrophages (LPS-stimulated or unstimulated) were determined by Sandwich Enzyme-Linked Immunosorbent Assay (ELISA; R&D systems) according to manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
NR Patel, A Blanks, Y Li, MC Prieto, SM Meadows,
bioRxiv - Molecular Biology 2021
Quote:
... cells transfected with Atp6ap2-siRNA or control-siRNA were serum starved overnight and stimulated with 20nM prorenin (Cayman chemical, 10007599) for indicated time points ...
-
No products found
because this supplier's products are not listed.
Ratnakar Potla, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for siRNA studies or Targefect-HUVEC (Targeting systems) for wild type and mutant construct overexpression studies ...
-
No products found
because this supplier's products are not listed.
Luis F. Queme, et al.,
bioRxiv - Neuroscience 2019
Quote:
... siRNAs were conjugated to Penetratin-1 (MP Biomedicals) as previously described 13 ...
-
No products found
because this supplier's products are not listed.
Easa Nagamalleswari, et al.,
bioRxiv - Molecular Biology 2022
Quote:
siRNA for the replacement studies was ordered from Amsbio (EME1 ...
-
No products found
because this supplier's products are not listed.
Jeremy Tsung-Chieh Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... alone were applied on the surface of the SN (2 µg of the target siRNA or scrambled-siRNA mixed with i-Fect™ (Neuromics, Edina, MN) in a ratio of 1:5 (W:V ...
-
No products found
because this supplier's products are not listed.
Sarah Lesage, et al.,
bioRxiv - Microbiology 2021
Quote:
... siRNAs were transfected using an Evo 150 with MCA384 (Tecan). The library contained 1158 siRNA targeting 386 genes ...
-
No products found
because this supplier's products are not listed.
Baokun Sui, et al.,
bioRxiv - Microbiology 2019
Quote:
... siRNAs or treated with EZH2 specific inhibitor gsk126 (Apexbio, A3446) for indicated time ...
-
No products found
because this supplier's products are not listed.
Mengru Zhuang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Mapk8ip3 was carried out with GeneSilencer siRNA Transfection Reagent (Genlantis) following the previously reported protocol 37 ...
-
No products found
because this supplier's products are not listed.
Srimoyee Mukherjee, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... All siRNAs and primers were purchased from Eton Biosciences (San Diego, CA). Inducible Lentiviral shRNA constructs targeting CstF64 were purchased from GE Healthcare Dharmacon ...
-
No products found
because this supplier's products are not listed.
John Sargeant, et al.,
bioRxiv - Cell Biology 2021
Quote:
... All siRNAs were custom synthesized lacking chemical modifications by Gene Link (Elmsford, NY).
-
No products found
because this supplier's products are not listed.
Minsoo Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
RNA from siRNA knockdown samples were isolated with Quick-RNA Miniprep kit (Zymo). cDNA library was generated with 500 ng of RNA ...
-
No products found
because this supplier's products are not listed.
Michael J. Munson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The tertiary siRNA screen was carried out utilising an ImageXpress Micro Confocal (Molecular Devices) using a 20x objective (NA 0.45) ...
-
No products found
because this supplier's products are not listed.
Valery Adorno-Cruz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... OFP-CCND1 cDNA vector in addition to either siRNA control or siITGA2 (Sino Biological, CV025 ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Fukumura, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... total RNAs were isolated from the siRNA-treated cells using a NucleoSpin RNA kit (Macherey-Nagel). To check depletion of the siRNA-targeted proteins ...
-
No products found
because this supplier's products are not listed.
Yingying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and cloned under U6 promoter in pSilencer5.1-U6 vector to produce hairpin siRNAs (shRNAs; Vector Biolabs, NM_020293). shRNA was packaged into adeno-associated virus constructs ...
-
No products found
because this supplier's products are not listed.
Esra Atalay Şahar, Petek Ballar Kirmizibayrak,
bioRxiv - Cancer Biology 2023
Quote:
Proliferation rate of SVIP siRNA-transfected and negative siRNA transfected MCF7 and T47D cells were monitored using the xCELLigence impedance-based real-time cell analysis system (ACEA Biosciences, USA). MCF7 and T47D cells were seeded (8000 cells/well ...
-
No products found
because this supplier's products are not listed.
Anais Prouteau, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and SPPL2A and control siRNA (IDT) were transfected into two human cell lines (HMV-2/CVCL_1282 -Merck-, WM3211/CVCL_6797 -Rockland-) using Lipofectamine 2000 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
HSCs transfected with siRNAs or treated with compounds were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Cat. # 15710) for 15 min at room temperature (RT) ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Microinjections for siRNA rescue and immunofluorescence were performed as described in [22,53] using a Xenoworks microinjection system (Sutter Instruments), A stable cell line expressing Lifeact-mCherry was created to analyse actin retrograde flow by infecting NIH3T3 fibroblasts with lentivirus carrying LifeActin-mCherry produced in HEK 293T cells (pLALI backbone).
-
No products found
because this supplier's products are not listed.
Marilia H Cordeiro, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HeLa FRT cells were released from thymidine block (40 h after siRNA treatment) for 7 hours before arresting at the G2/M boundary with RO-3306 treatment (10μM, Tocris) for 2 hours ...
-
No products found
because this supplier's products are not listed.
Daigo Inoue, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The siRNA-treated keratinocytes were further incubated by replacing the medium with the coculture medium (CnT-PRIME KM, CELLnTEC) for the coculture with melanocytes.
-
No products found
because this supplier's products are not listed.
Liron Marnin, et al.,
bioRxiv - Microbiology 2023
Quote:
... Unfed nymphs were microinjected with 60-80 ng of siRNA or scRNA using a Nanoject III (Drummond Scientific Company). Ticks recovered overnight at 23°C with saturated humidity.
-
No products found
because this supplier's products are not listed.
Zezhou Zhao, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... successful transfection was confirmed by examining uptake of labeled siRNA with an Eclipse TE200 inverted microscope (Nikon Instruments, Melville, NY). Transfection medium was removed ...
-
No products found
because this supplier's products are not listed.
Wen Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the organic phase was prepared by mixing 20 μL siRNA (4 nmol in water) with 1 mL PLGA (Durect Corporation) (5mg/mL in acetone ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 2 μL volume of distinct siRNA was delivered into the amygdala with a Hamilton syringe (Hamilton Company, Reno, NV). The siRNAs included 1 μg/μL LCN2 siRNA ...
-
No products found
because this supplier's products are not listed.
Radhika Gudi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Switzerland and the CPAP siRNA targeting sequence has been reported earlier59.Primary antibodies used in this study: anti-CPAP (Proteintech), -GFP (Santa Cruz Biotech ...
-
No products found
because this supplier's products are not listed.
Madeline Otto, Sigrid Hoyer-Fender,
bioRxiv - Cell Biology 2023
Quote:
... Plasmid DNA or siRNA was transfected using EndoFectinTM Max Transfection Reagent following the manufactureŕs instructions (#EF014, GeneCopoeia, Inc., Rockville, USA). For Odf2 knockdown ...
-
No products found
Katherine Schutt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
RPE1 cells inducibly expressing siRNA resistant GFP-KIF18A were seeded into glass-bottom 24-well dishes (Cellvis, P24-1.5h-N). Cells were treated with 2 μg/mL doxycycline (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Brooke A. Hall, et al.,
bioRxiv - Microbiology 2024
Quote:
... 10 μg of total protein for both NT and Rab siRNA-transfected samples were resolved in 4-20% gradient SDS-PAGE (Mini-PROTEAN Gel ...
-
No products found
because this supplier's products are not listed.
Qin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Cells were seeded into 96-well culture plates at the density of 3000 cells per well after transfected with siRNA oligos and cultured for 5 days with the viability measured daily using the Cell Counting Kit-8 (CCK8) (TargetMol) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Maciej Jerzy Smialek, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Detection of apoptotic TCam-2 cells was performed 48 h after transfection of TCam-2 cells with control and KIF18A siRNA constructs using an Annexin V-FITC Apoptosis Detection Kit (Beckman Coulter), according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Elena V. Galitsyna, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or 100 pmol/mL of SC-siRNA and linear polyethylenimine (PEI) with a molecular weight of 25 kDa (23966-1; Polyscience, USA) in a 1:3 ratio (μg of siRNA ...
-
No products found
because this supplier's products are not listed.
Fabiana Martino, et al.,
bioRxiv - Pathology 2022
Quote:
... The RNA resultant from RIP of heart tissue or resultant from NHDF transfection with hnRNPC siRNA and the respective control construct was sequenced on an Illumina Nextseq 550 sequencer (Illumina, CA, USA) to 25-35 million single-end 75bp reads and >50 million paired-end 75 bp reads per sample ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Ionel Sandovici, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Small interfering RNA (siRNA) knockdown of Igf2r was performed on primary placental microvascular endothelial cells isolated from C57BL/6J mice (Cell Biologics, C57-6056) and grown in Cell Biologics’ complete growth medium (M1168 ...
-
No products found
because this supplier's products are not listed.
Wolfgang Giese, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Nuclear tracking assays were carried out 52 hours after siRNA transfection and EC nuclei were tracked for 17 hours using a confocal microscope (Carl Zeiss, LSM 980), equipped with a Plan-Apochromat 20×/0.8 NA Ph2 air objective and the Definite Focus system ...
-
No products found
because this supplier's products are not listed.
Desh Raj, et al.,
bioRxiv - Cell Biology 2023
Quote:
... siRNAs and inhibitors for different time point were checked for PIP2 level by using PIP2 Mass ELISA kit (Echelon Biosciences Inc., USA K-4500).
-
No products found
because this supplier's products are not listed.
Eleonora Lugarà, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were generated by the insertion of three different siRNA sequences (obtained from Dharmacon, Horizon Discovery, supplementary table 1) into AAV U6 GFP (CELL BIOLABS INC., San Diego, CA 92126, USA) using BamH1 and EcoR1 restriction sites ...