-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
Creative-Proteomics Mouse Inflammation Glass protein array, detected 40 Mouse proteins. Suitable...
Cat# MQ-InPA-CPG,
inquiry, contact supplier for pricing
Ask
Emily C. Pierce, et al.,
bioRxiv - Microbiology 2020
Quote:
Biotin quantification of CCA medium was performed on three replicate samples by Creative Proteomics (NY, USA) as follows ...
-
No products found
because this supplier's products are not listed.
Pierre-Olivier Estève, et al.,
bioRxiv - Genetics 2020
Quote:
The isolated Biotin-labeled genomic DNA from fixed reactions were sonicated into 150 bp fragments (Covaris) and 200 ng of DNA was mixed with 50 μl of Streptavidin magnetic beads (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Christian Kofoed, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and Biotin-PEG3-amine (CAS NO 359860-27-8) were purchased from Ambeed (Arlington Heights, IL). Triethylamine (CAS NO 121-44-8 ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
The Biotin Collagen Hybridizing Peptide (CHP) is a synthetic peptide that can specifically bind...
Cat# 5265-60UG,
0.3 mg, USD $290.0
Ask
Yiting Deng, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... the sections were incubated with 20 µM biotin-conjugated collagen hybridizing peptide (Advanced Biomatrix, 50-196-0307) in 1X PBS at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Maria Körner, et al.,
bioRxiv - Cell Biology 2023
Quote:
Pulldown assays using immobilized GST fusion proteins or biotinylated peptide (Biotin- CQGLYFHINQTLREAHFHSLQHRG-COOH; PANATecs GmbH, Tübingen, Germany) were essentially performed as described (Böhm et al ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slides were washed and incubated with TSA (Tyramide Signal Amplification Biotin System, NEL-700 NEN Life Science Products) diluted to a 1:100 concentration in amplification diluent ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Breanna Q. Shen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Slides were incubated with blocking buffer (10% Normal Goat Serum, Atlanta Biologicals, Cat #S13150h ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Probe DNA (mouse rDNA BAC clone RP23-225M6, Empire genomics) was mixed with Hybridization buffer (50% formamide ...
-
No products found
because this supplier's products are not listed.
Christopher Jonkergouw, et al.,
bioRxiv - Biochemistry 2023
Quote:
... dosed with LPS (50µl/mouse) using a P100 pipette (Gilson). The animals were held upright for a short period of time after dosing to allow for substance distribution down the respiratory tract ...
-
No products found
because this supplier's products are not listed.
Scott P. Souza, et al.,
bioRxiv - Immunology 2021
Quote:
... and blocked with coating buffer containing with 1% BSA (w/v) and 2% goat serum (Omega Scientific) in PBS ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse embryonic fibroblasts (MEFs) were cultured using DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Chen Jiang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Primary mouse keratinocytes were kept in culture medium (CnT-07; Cellntec) at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Karl A. Johnson, et al.,
bioRxiv - Biophysics 2020
Quote:
... we imaged a GFP labelled mouse brain sample acquired from SunJin Lab (Hsinchu City, Taiwan). This sample is a 250um thick coronal section which was cleared and mounted by SunJin Lab using the RapiClear 1.52 reagent.
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
Adrienne Samani, et al.,
bioRxiv - Genetics 2023
Quote:
... Primary mouse myoblasts were grown in Skeletal Muscle Cell Growth Medium (Promocell Cat# C-23060; Heidelberg, Germany) with 20% FBS (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Sara M. Blazejewski, et al.,
bioRxiv - Neuroscience 2020
Quote:
pCAG-eCas9-GFP-U6-Rpsa-gRNA plasmid was transfected into mouse Neuro-2a cells using PolyJet transfection reagent (SignaGen Laboratories), and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Piyakarn Boontem, Tetsumori Yamashima,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... rabbit anti-human activated μ-calpain antibody (PEPTIDE Institute, Japan) at 1:250 overnight ...
-
No products found
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
Sahil Shah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Then the promoter activities were tested in C20 human microglia and SIM-A9 mouse microglia cell lines using Glial-Mag kit (OZ Bioscience, Cat # GL002500). The cells were cultured under standard conditions and seeded into 96-well plates at a density of 3.0×104/100 μl ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Membranes were overnight probed in 1/1000 Rabbit Anti-Human APOBEC3G (Immunodiagnostics Inc.), washed three times ...
-
No products found
because this supplier's products are not listed.
Amrita Das Gupta, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-IBA1 (polyclonal rabbit) antibody (Fujifilm – Cellular dynamics; #019-19741; dilution 1:250), Anti-S100ß (polyclonal chicken ...
-
No products found
because this supplier's products are not listed.
Frederike Klimm, Thomas Speck, Marc Thielen,
bioRxiv - Plant Biology 2023
Quote:
... by using the primary antibody LM6 ([Anti-1,5-α-L-Arabinan] Antibody, Megazyme Ltd, Bray, Ireland) and a fluorescent marker (Alexa Fluor 568 goat anti-rat IgG (H+L) ...
-
No products found
because this supplier's products are not listed.
Jorge Lascano, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Plates were washed and samples incubated with rabbit anti-human NE (Athens Research and Technology, Athens, GA) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...