1 - 50 of 384
suppliers found for
Genotyping kit
» view 10000+ matched products-
Creative Enzymes Sponsored
Cat# CE-3013, 100 ug, contact supplier for pricing Ask
-
Roche
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... Genotyping using barley 50K iSelect BeadChip kits (Illumina) was performed according to the manufacturer’s instructions ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in Constitutive activation of the PI3K-Akt-mTORC1 pathway sustains the m.3243A>G mtDNA mutationbioRxiv - Cell Biology 2021Quote: ... to the website of online Custom TaqMan® Assay design tool (https://www.thermofisher.com/order/custom-genomic-products/tools/genotyping/) The Custom TaqMan SNP Genotyping Kit (Applied Biosystems #4332073) was ordered and prepared according to manufacturer instructions ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... Genotyping was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma, KK7352) using GFP primers ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020, published in Scientific Reports doi: 10.1038/s41598-020-80824-xQuote: Genotyping was standardized using PCR amplification (QIAGEN kit ref. 201445). DNA was obtained from ear punch using the KAPA BIOSYSTEMS kit (ref ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: Genotyping was performed with Q5 polymerase (NEB), primers fwd 5’-GTTAAAACAGTTTCTTAAAAAGAACAGGA-3’ and rev 5’-AGCAGAAGAAATGACTCAACATTTTG-3’ (annealing at 62°C ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Genotyping was confirmed following protocols from Jackson Laboratory for JAX Stock #021047 and #012933 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Genotyping PCRs were performed using GoTaq Green Mastermix (Promega) (Fig ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: Genotyping of ClC-7 KO U2OS clone was performed using an Extract PCR-Kit (Bioline) with the following primers ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: Genotyping was done using the Terra PCR Direct Polymerase Mix and kits (Takara Bio; Shiga, Japan). The primers used for genotyping are given in supplementary table 1 ... -
Neogen Corporation
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... SNP genotyping was performed by Neogen Inc ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... PIK3CA genotyping assays from Bio-Rad were used to specifically detect the PIK3CAE542K mutation on DNA samples ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: ... or NucleoSpin Tissue kit (routine genotyping; Macherey-Nagel #740952.25). OneTaq DNA polymerase (New England BioLabs #M0480 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... Genotyping of the mice was performed with the KAPA Mouse Genotyping Hot Start Kit (Merck, Darmstadt, Germany) using abca4_wt_f GCCCGCACTTGTGTATTTAG ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... Genotyping PCR was performed using Failsafe PCR 2x PreMix H (Lucigen) and Taq polymerase (NEB). -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Stem Cell Reports doi: 10.1016/j.stemcr.2018.10.003Quote: ... short-tandem repeat (STR) genotyping [The Centre for Applied Genomics (TCAG)] and mycoplasma (Lonza MycoAlert). Directed differentiation was performed using kits for definitive endoderm ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Genomics 2020Quote: Pieces of caudal fin sampled from those 1,152 fish were sent to Gentyane genotyping platform (INRAE, Clermont-Ferrand, France) for DNA extraction using the DNAdavance kit from Beckman Coulter following manufacturer instructions ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Current Biology doi: 10.1016/j.cub.2020.05.004Quote: ... Genotyping PCR was performed using Taq polymerase on genomic DNA extracted from SMB55 cells using ZymoBead™ Genomic DNA kit (Zymo). Genomic DNA extracted from Ptch1-/- mouse embryonic fibroblasts and a wild-type mouse were used as a control for the mutant and wild-type alleles respectively ... -
abcam
No products found because this supplier's products are not listed.Cited in The immune response is a critical regulator of zebrafish retinal pigment epithelium regenerationbioRxiv - Immunology 2020Quote: ... Genotyping PCR products were digested with AvaI restriction enzyme (Abcam, Cambridge, Massachusetts) for 1 hour at 37°C and electrophoresed on a 3% agarose gel in 1X Tris-acetate-EDTA (TAE ... -
Viagen Biotech
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... Genotyping of mutant embryos was performed after a lysis step (Lysis Buffer (Viagen)) with 1,5% Proteinase K (Qiagen). -
Alere Technologies
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... aureus genotyping Kit 2.0 (Alere Technology, Jena, Germany) as described previously [10] ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Epigenetics & Chromatin doi: 10.1186/s13072-019-0284-7Quote: ... Then the embryo was split in two parts: the head was used for genotyping and the hindgut was dissected and mounted in Vectashield (Vector Laboratories) for observation with confocal microscopy. -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2017, published in Systematic Biology doi: 10.1093/sysbio/syx050Quote: ... 1 kit (Agilent Technologies Custom SureSelect XT kit), which contained probes for 517 flowering plant exons (average ... -
Biosearch Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... genotyping was performed using KASP primer pairs (Biosearch Technologies) targeting the following sequence ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... validated by genotyping PCR that was analyzed on a 1% agarose gel imaged with a Typhoon FLA 9500 scanner (GE Healthcare). Subsequent Sanger sequencing of the PCR product (Microsynth ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Scientific Reports doi: 10.1038/s41598-019-42765-yQuote: ... Single cells from each cell type (Kit- CD41-, Kit+ CD41-, Kit+ CD41+ and Kit- CD41+) were sorted with the FACSAria fluorescence cell sorter (BD Biosciences) into 96-well plates filled with 2 x lysis buffer from the CellsDirect One Step qRT-PCR Kit (Invitrogen ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Early neutrophilia marked by aerobic glycolysis sustains host metabolism and delays cancer cachexiabioRxiv - Cancer Biology 2021Quote: ... c-Kit (BioLegend), EpCam (G8.8 ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... following manufacturer instructions (Dead cell removal kit; Debris removal kit; Miltenyi Biotec) resulting in ~80% of purity and CD3+ T cells were resuspended in 1X PBS with 0.04% BSA ... -
Omega Bio-Tek
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020Quote: ... and all genotyping was performed with RedTaq Polymerase (VWR). Since for ScoGCFP-AP2 we obtained more than 100 G1 transgenic founder individuals ... -
Applied Biological Materials
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...Cat# G628, 100 Rxns/kit, please contact supplier for pricing. AskbioRxiv - Cancer Biology 2022Quote: ... The cell line identities were confirmed by genotyping using short tandem repeat fingerprinting and were tested negative for mycoplasma with Mycoplasma PCR Detection Kit (ABM). -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: The Allegro Targeted Genotyping V2 protocol (publication number M01501, Tecan Genomics, Inc.) was followed for library preparation of all samples in duplicate with the Allegro and JAX probe pools ... -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in Hematopoietic Stem and Progenitor Cells Use Podosomes to Transcellularly Home to the Bone MarrowbioRxiv - Cell Biology 2018Quote: ... Murine c-kit+ HSPC were isolated with c-kit microbeads (StemCell Technologies). HSPC were thoroughly washed in PBS and injected intravenously into recipient mice irradiated with a dose of 5 Gy ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in Activation of JUN in fibroblasts promotes pro-fibrotic programme and modulates protective immunitybioRxiv - Immunology 2020Quote: ... The expression of PD-L1 and IL-6 from bronchoalveolar lavages was quantitated following the protocols of ELISA kits: Human IL-6 Quantikine ELISA Kit and Human/Cynomolgus Monkey B7-H1/PD-L1 Quantikine ELISA Kit from R&D Systems. -
Biovision
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2019Quote: Bulk methyl and O-acetyl ester content of AIR samples was carried out using commercial kits (Methanol Assay Kit, and Acetate Assay Kit, BioVision, CA, USA). AIR samples (2.5 mg ... -
PerkinElmer
No products found because this supplier's products are not listed.Cited in Krüppel-like factor 2- induced microRNAs: implications for treatment of pulmonary hypertensionbioRxiv - Cell Biology 2019Quote: ... Fluorescein Evaluation Kit System (PerkinElmer) were used according to manufactures’ protocols (Wang et al. ... -
American BioInnovations,
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020, published in Translational Psychiatry doi: 10.1038/s41398-020-01020-zQuote: ... rs5030655 (1707delT) were examined using Taqman® SNP Genotyping Assays (ABI Life Technologies, USA). Briefly ... -
Genesee Scientific
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in RNA doi: 10.1261/rna.068932.118Quote: Genotyping PCR reactions were performed with gDNA using Apex Taq DNA Polymerase (Genesee Scientific). The first set of primers flanked the deletion and identified clonal lines with at least one allele deleted ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: Plant genotyping was performed by CEL1 assay and/or Sanger sequencing (for the EMS mutants) and by PCR (for T-DNA mutants) ... -
Favorgen Biotech
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Developmental Biology doi: 10.1016/j.ydbio.2019.10.037Quote: ... Tail fin pieces are used for genotyping while trunk and head fragments are frozen down in RNA extraction buffer (Favorgen) and stored in −80°C until genotypes of each embryo is known ... -
Addgene
No products found because this supplier's products are not listed.Cited in Simple and efficient modification of Golden Gate design standards and parts using oligo stitchingbioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ... -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019, published in Biology of Reproduction doi: 10.1093/biolre/ioz089Quote: ... kit (Omega Biotek) according to manufacturer’s protocol ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... ELISpot kits (Mabtech) measuring Th1 cytokines (IFN-γ ... -
TianGen Biotech
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2017, published in Frontiers in Plant Science doi: 10.3389/fpls.2018.00554Quote: ... RNA extraction kit and qRT-PCR kit were purchased from Tiangen Company ... -
Megazyme
No products found because this supplier's products are not listed.Cited in Classifying interactions in a synthetic bacterial community is hindered by inhibitory growth mediumbioRxiv - Microbiology 2022Quote: ... Citric acid kit: Citric Acid Assay Kit (Megazyme, product Code: K-CITR). Phosphate kit ... -
Diagenode
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019, published in PLOS ONE doi: 10.1371/journal.pone.0214559Quote: ... MethylCap kit (Diagenode, C02020010) was employed to obtain the methylated DNA ... -
Active Motif
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ChIP assays were performed with a commercial kit (Chip-IT kit, Active motif). The cortices from P2 wildtype mice were minced and crosslinked in 1% formaldehyde (F8775 ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... Kit (Cell Signaling Technology, 3074), Ido1 (Santa Cruz Biotechnology ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Serum was stored at -20°C until later assayed for ACTH and CORT using commercially available enzyme-linked immunosorbent assay kits according to the manufacturers’ instructions (ACTH kit: cat# EK-001-21, Phoenix Pharmaceuticals, Burlingame, CA; CORT kit: cat# 501320, Cayman Chemical, Ann Arbor, MI). -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Antimicrobial Agents and Chemotherapy doi: 10.1128/aac.01379-18Quote: Gnome® DNA kit (MP Biomedicals) was used to extract genomic DNA ...