-
No products found
because this supplier's products are not listed.
Tincy Simon, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and chromosome 11 with MEN1 gene (Empire Genomics, USA). Hybridization was performed according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... rabbit anti- histone H2A (1:1,000; 11-7017, Abeomics), rabbit anti-pS10-histone H3 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Arijita Chakraborty, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Immunoprecipitation was carried out in 1X DRIP binding buffer (0.02% Tween 20 in 1X PBS) with 11 μg of S9.6 antibody (Kerafast) per reaction overnight at 4°C with constant rotation ...
-
No products found
because this supplier's products are not listed.
Tiago Monteiro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Fischer Elektronik) and 0.5-mm thick probes insulated with 1-mm wide polyimide tubing (95820-11, Cole-Parmer), whereas the latter had active heat dissipation via a water block (WBA-1.00-0.49-AL-01 ...
-
No products found
because this supplier's products are not listed.
Xiaojing Yue, et al.,
bioRxiv - Immunology 2019
Quote:
Anti-dsDNA autoantibodies in the serum from Foxp3Cre WT and Tet2/3fl/flFoxp3Cre mice (11-16 weeks old) were measured with kit from Alpha Diagnostic International according to the manufacturer’s protocol (ELISA Kit 5110).
-
No products found
Muhammad Saad Yousuf, et al.,
bioRxiv - Neuroscience 2020
Quote:
Dissociated DRG cultures for calcium imaging were prepared from freshly excised DRGs according to our previously published protocol (see “Dissociated dorsal root ganglia cultures”, 11) with STEMzyme I (2mg/ml; Worthington, LS004106) replacing collagenase IV ...
-
No products found
because this supplier's products are not listed.
Verena Haage, et al.,
bioRxiv - Neuroscience 2024
Quote:
... hiPSC lines used were MSN38 (Mount Sinai Normal, Icahn School of Medicine at Mount Sinai) and WTC-11 (Allen Institute for Cell Science). At mature age the COs were co-cultured with microglial progenitors (derived from WTC-11 ...
-
No products found
because this supplier's products are not listed.
Charlotte Garot, et al.,
bioRxiv - Bioengineering 2022
Quote:
... BMP-2 loading was quantified using a fluorescence spectrometer (Tecan Spark, Tecan Lyon, France) for BMP10 (excitation at 535 nm ...
-
No products found
because this supplier's products are not listed.
Sylvie Roy, et al.,
bioRxiv - Microbiology 2020
Quote:
... the media was replaced with serum-free media (SFM) BalanCD HEK293 (Fujifilm Irvine Scientific, Santa Ana, CA). The next day ...
-
No products found
because this supplier's products are not listed.
Senem Aykul, et al.,
bioRxiv - Cell Biology 2020
Quote:
... HEK293 cells expressing ACVR1 were pretreated with 100 nM MAB222 (RnD Systems) plus 20 nM SD208 (BioVision) for 3 hours after overnight starvation ...
-
No products found
because this supplier's products are not listed.
Yash Agarwal, et al.,
bioRxiv - Immunology 2020
Quote:
... Paraffin embedded fixed sections were stained via hematoxylin and eosin or with indicated human antibodies 24 (anti-human CD45-Biocare Medical Cat. No. CME PM016AA; anti-human CD3-Biocare Medical Cat ...
-
No products found
because this supplier's products are not listed.
Jordan A. Stinson, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... stable HEK293-F cell lines for each cytokine were prepared through cloning into the expression cassette of PiggyBac (System Biosciences) transposon vector ...
-
No products found
because this supplier's products are not listed.
Simon J. Cleary, et al.,
bioRxiv - Immunology 2024
Quote:
... These sequences were codon-optimized and antibodies were expressed as chimeric hIgG1 with or without Fc point mutations in a HEK293 cell system and purified using protein A and buffer exchange (Absolute Antibody).
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Aum R. Patel, et al.,
bioRxiv - Microbiology 2021
Quote:
Normal Adult Human Dermal Fibroblasts and Normal Human Skeletal Muscle Satellite Cells (SkMc) (Lifeline Cell Technologies, USA) were cultured using FibroLife S2 Medium and StemLife SK Medium ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Christin Naumann, et al.,
bioRxiv - Plant Biology 2021
Quote:
... All reagents except human ceruloplasmin (Athens Research) were purchased from Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joelle P. Straehla, et al.,
bioRxiv - Bioengineering 2021
Quote:
Human iPS-ECs (Fujifilm Cellular Dynamics, 11713), human brain PCs and ACs (ScienCell) ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Chang-Hoon Kim, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant Flag-tagged human G9a (Active Motif, 31410), human calpain 1 (Novus ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Lars Gruber, et al.,
bioRxiv - Biochemistry 2023
Quote:
Monoculture and biculture spheroids of CCD-1137Sk human fibroblasts and HT-29 human colon cancer cells (both LGC Standards, Wesel, Germany) were prepared ...
-
No products found
because this supplier's products are not listed.
Jessica Ciesla, Isreal Moreno Jr., Joshua Munger,
bioRxiv - Microbiology 2022
Quote:
TNFα (Human) was purchased from GoldBio (#1130-01-100) and suspended in sterilized water to 1 mg/mL concentration ...
-
No products found
because this supplier's products are not listed.
Lynlee M. Stevey-Rindenow, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Size 11 (Curad®, Medline, Mundelein, IL, USA), and Elastikon (Johnson & Johnson Consumer Companies ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Potassium iodide (CAS# 7681-11-0) from Caledon laboratory, Citric acid monohydrate (CAS# 5949-29-1 ...
-
No products found
because this supplier's products are not listed.
Motokazu Uchigashima, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 11 glucose and 0.001 mM tetrodotoxin (TTX, Hello Bio Inc), gassed with 5% CO2/95% O2 ...
-
No products found
because this supplier's products are not listed.
Iris Bea. L. Ramiro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Consomatin Ro1crystallized after 11 days at 21 °C in SaltRx (Hampton Research), condition D10 (4.0 M Sodium Nitrate ...
-
No products found
because this supplier's products are not listed.
Piyali Guhathakurta, et al.,
bioRxiv - Biophysics 2020
Quote:
The compounds of interest (11) were purchased from TargetMol (Boston, MA USA) at 10 mM stocks in DMSO ...
-
No products found
because this supplier's products are not listed.
Lu Hu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The samples were then added 11 11L of 6xSDS loading buffer (BP-111R, Boston BioProducts) and denatured at 95°C for 5 mins ...
-
No products found
because this supplier's products are not listed.
Jensen H. C. Yiu, et al.,
bioRxiv - Systems Biology 2023
Quote:
Immunoblotting was conducted as described previously.11 The anti-flagellin antibodies were purchased from Covalab Inc ...
-
No products found
because this supplier's products are not listed.
Emma Rusilowicz-Jones, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an 11-point dilution series of compounds were dispensed into black 384-well plates using an Echo (Labcyte). USP30 ...
-
No products found
because this supplier's products are not listed.
Hongxu Dong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 35 g of slow release fertilizer (Osmocote Pro 17-5-11, 6 months; ICL Specialty Fertilizers, Dublin, OH, USA) was added at planting and after 6 months ...
-
No products found
because this supplier's products are not listed.
Michael C Farruggia, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The gustometer system (51) is a portable device controlling 11 programmable BS-8000 syringe pumps (Braintree scientific, Braintree, Ma). Pumps are loaded with 60 mL syringes filled with milkshake ...
-
No products found
because this supplier's products are not listed.
Pearl V. Ryder, Junnan Fang, Dorothy A. Lerit,
bioRxiv - Developmental Biology 2020
Quote:
... or blocked magnetic beads (Chromotek, bmp-20) for GFP-Trap of FMRP ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
Kyle E. Harvey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were alternatively excited at 340/11 nm and 380/20 nm wavelengths using a band pass filter shutter (Sutter Instrument) and changes in intracellular Ca2+ were measured by recording the ratio of fluorescence intensities at 508/20 nm in time lapse (time interval of 0.6 seconds ...
-
No products found
because this supplier's products are not listed.
Erik van Tilburg Bernardes, et al.,
bioRxiv - Microbiology 2019
Quote:
... F1 mice at 7 weeks of age (7-11/treatment group) were treated for 5 consecutive days with 1.5% DSS (Alfa Aesar, Haverhill, MA, USA) in sterile drinking water ...
-
No products found
because this supplier's products are not listed.
Lyra O. Randzavola, et al.,
bioRxiv - Immunology 2022
Quote:
... HEK293-F were transfected with polyethylenimine (Polyscience Europe GmbH) at a ratio of 1:3 DNA:polyethylenimine (Tom et al. ...
-
No products found
because this supplier's products are not listed.
Luis Alfonso Yañez Guerra, Meet Zandawala,
bioRxiv - Evolutionary Biology 2023
Quote:
... HEK293-G5a (Angio-proteomie CAT no. cAP0200GFP-AEQ-Cyto) cells were cultured in 96 well-plates containing 100μl of DMEM (Thermo ...
-
No products found
because this supplier's products are not listed.
Silvia De Cicco, et al.,
bioRxiv - Neuroscience 2020
Quote:
NFAT Reporter - HEK293 Cell Line (PKC/ Ca2+ Pathway) cell lines were purchased from Tebu-Bio and cultured in Dulbecco’s MEM (Merck ...
-
No products found
because this supplier's products are not listed.
S Momsen Reincke, et al.,
bioRxiv - Immunology 2021
Quote:
... Human mAbs were applied and detected using HRP-conjugated anti-human IgG (Dianova, 709-035-149) and the HRP substrate 1-step Ultra TMB (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Sergey Matveevsky, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... human anti-centromere antibodies CREST (Fitzgerald Industries International ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human DARPP-32 isoforms purified from NSCLC cells were incubated with kinase-activated human IKKα protein (SignalChem) for in vitro kinase assays by following previously described methods70 ...
-
No products found
because this supplier's products are not listed.
Katharina Hoette, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Isolation of organoids from the embedding matrix (human hepatic organoids: Matrigel, Corning; human pancreatic organoids: Cultrex BME2, Amsbio) for fixation and whole-mount staining was performed with slight modifications of protocols published by Broutier et al ...
-
No products found
because this supplier's products are not listed.
Diego Gilioli, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10% Human Serum (cat#ECS0219D from Euroclone) and IL-2 (cat#F027131010 from Novartis ...
-
No products found
because this supplier's products are not listed.
Yuliya Kurlishchuk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 20 ng/ml human EGF (Biomol). All cells were kept at 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Maciej Kliszczak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-human FAM111B (HPA038637, Atlas Antibodies) at 1:1000 (IB and IF) ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
... containing 100 U/mL recombinant human IL-2 (rhIL-2, Novartis Oncology) and 0.5 ng/mL recombinant human IL-15 (rhIL-15, CellGenix). For CAR lentiviral transduction ...
-
No products found
because this supplier's products are not listed.
Fred E. Fregoso, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and to subclone construct Arpin_CA (residues 194-226). The gene encoding human N-WASP/human Arpin hybrid construct Hybrid_WH2 (Fig. 4a) was synthesized (Biomatik). Other N-WASP/Arpin hybrid constructs (Fig ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Pooled human plasma was acquired from Zen-Bio Inc ...