-
No products found
because this supplier's products are not listed.
Jessica A. Higginbotham, et al.,
bioRxiv - Neuroscience 2020
Quote:
... N- (Piperidin-1-yl)-5- (4-iodophenyl)-1- (2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 3 mg/kg; Sigma Aldrich, St. Louis, MO), or vehicle (VEH ...
-
No products found
because this supplier's products are not listed.
Dominique Massey-Harroche, et al.,
bioRxiv - Cell Biology 2023
Quote:
... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 5 µM, Tocris); Tetrodotoxin (TTX ...
-
No products found
because this supplier's products are not listed.
Rei Yagasaki, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and 0.035 mg/ml 5-bromo-4-chloro-3-indolyphosphatase (Roche). Images were acquired by the Leica MZ10F microscope with the DS-Ri1 camera.
-
No products found
because this supplier's products are not listed.
Agnieszka Czarnocka-Cieciura, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Maria V. Sinegubova, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Udita Chandola, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 °C) and the cells were resuspended in 5 mL of methanol/dichlormethane/ethylacetate 10:2:3 (dichlormethane: SupraSolv, VWR Chemicals ...
-
No products found
because this supplier's products are not listed.
Ricardo N. Ramirez, et al.,
bioRxiv - Immunology 2021
Quote:
... 3 ug Yy1 (Abcam ab109237) and 5 ug rabbit IgG (Cell Signaling 2729S) ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Kyle D. Apley, et al.,
bioRxiv - Bioengineering 2023
Quote:
Splenocytes from 125Tg B6 and WT B6 control mice were stained with CellTrace Violet and cultured for 3 days35 in complete RPMI alone or stimulated with 5 ug/mL anti-mouse anti-CD40 (BD Pharmingen clone HM40-3) in the presence or absence of conjugates described above at 150 nM concentrations ...
-
No products found
because this supplier's products are not listed.
Evan R. Semenza, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 0.1 mg/mL 2-cyano-6-hydroxybenzothiazole (Santa Cruz). In the case of cultured cells ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Alba Escalera, et al.,
bioRxiv - Microbiology 2021
Quote:
... and puromycin (3 ug/mL) (InvivoGen). All cell lines were grown at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Hejian Xiong, et al.,
bioRxiv - Neuroscience 2021
Quote:
1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC, 63-89-8, >99%) and cholesterol (ovine wool, 57-88-5, >98%) were purchased from Avanti Polar Lipids, Inc ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-cyano-7-ethoxycoumarin (CEC, 30 μM; Cyp1a2; Cat. No. 451014. Corning Inc.), coumarin (CM ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Jason A Iskarpatyoti, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL recombinant murine IL-3 (R&D Systems, and 5% stem cell factor-containing supernatant from CHO-KL cells for 4-6 weeks until maturation ...
-
No products found
because this supplier's products are not listed.
Juan J. Apiz-Saab, et al.,
bioRxiv - Cancer Biology 2022
Quote:
13C4 3-hydroxybutyrate (Cambridge Isotope Laboratory, Andover, MA, CLM-3853)
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Matthew J. Burke, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
No products found
because this supplier's products are not listed.
Siyi Huang, et al.,
bioRxiv - Immunology 2019
Quote:
... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Riccardo Turchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
Quantification of energy metabolites and cofactors was performed using a cyano-phase LUNA column (50mm x 4.6mm, 5 µm; Phenomenex) with a 5.5 min run in negative ion mode with two separated runs ...
-
No products found
because this supplier's products are not listed.
Henrike O. Heyne, et al.,
bioRxiv - Genetics 2019
Quote:
... Cells were rinsed with PBS (5 mL) and treated with 3 mL Accutase (STEMCELL technologies) for 5 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Lauren Rice, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% (v/v) (3-Aminopropyl) triethoxysilane (APTES) (98%, Alfa Aesar, USA) was added to coverslips in Milli-Q water and incubated for 15 min ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Goki Tsujimoto, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 3-Mercaptopicolinic Acid (5 mM; Cayman chemical, 20895).
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Kwangdeok Shin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Zebrafish ventricles were fixed in 3% PFA for 5 min and incubated in PBS supplemented with 1 mg/mL collagenase type 4 (Worthington Biochemical) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Yujie Ye, et al.,
bioRxiv - Biophysics 2022
Quote:
... The matrix α-Cyano-4-hydroxycinamic acid (TCI C1768), was dissolved in 75 % HPLC-level acetonitrile coupled with 0.1 % TFA and sonicated 15 minutes ...
-
No products found
because this supplier's products are not listed.
Birte Blunk, et al.,
bioRxiv - Microbiology 2020
Quote:
... N-(3-Aminopropyl) methacrylamide hydrochloride (APMA, >98%) was obtained from Polysciences Inc ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Christopher P. Knapp, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... Animals were obtained at either 3-4 weeks old/50-75g (behavioral experiments) and 5-6 weeks old/100-125g (Western blotting experiments) from Charles River Laboratories and housed in a 12h:12h reverse light/dark cycle facility ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Lihong Wang-Bishop, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Mice in groups receiving αPD-1 and αCTLA-4 (100 µg, every 3 days for 5 injections, BioXcell, West Lebanon NH) were treated intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Mirushe H. Miftari, Bernt T. Walther,
bioRxiv - Developmental Biology 2022
Quote:
... embryos were paraffin-embedded and serially sectioned at 3-5 µm (Leica microtome), before attachment to poly-L-lysine-coated glass slides (Sigma ...